#genome
stringclasses 121
values | asm_name
stringclasses 120
values | assembly_accession
stringclasses 120
values | bioproject
stringclasses 45
values | biosample
stringclasses 120
values | wgs_master
float64 | seq_rel_date
stringclasses 98
values | submitter
stringclasses 76
values | ftp_path
stringclasses 120
values | img_id
float64 637M
2.51B
⌀ | gtdb_id
stringclasses 120
values | scope
stringclasses 3
values | assembly_level
stringclasses 1
value | genome_rep
stringclasses 1
value | refseq_category
stringclasses 3
values | release_type
stringclasses 2
values | taxid
float64 1.15k
681k
⌀ | species_taxid
float64 7
911k
⌀ | organism_name
stringclasses 120
values | infraspecific_name
stringclasses 112
values | isolate
stringclasses 1
value | superkingdom
stringclasses 2
values | phylum
stringclasses 18
values | class
stringclasses 30
values | order
stringclasses 56
values | family
stringclasses 75
values | genus
stringclasses 89
values | species
stringclasses 117
values | classified
bool 1
class | unique_name
stringclasses 121
values | lv1_group
stringclasses 2
values | lv2_group
stringclasses 13
values | score_faa
float64 0.93
1
⌀ | score_fna
float64 0.88
1
⌀ | score_rrna
float64 0.1
1
⌀ | score_trna
float64 0.6
1
⌀ | total_length
float64 618k
9.12M
⌀ | contigs
float64 1
22
⌀ | gc
float64 22.5
72.2
⌀ | n50
float64 616k
9.03M
⌀ | l50
float64 1
1
⌀ | proteins
float64 525
7.92k
⌀ | protein_length
float64 172k
2.68M
⌀ | coding_density
float64 74
96.9
⌀ | completeness
float64 76.3
100
⌀ | contamination
float64 0
4.4
⌀ | strain_heterogeneity
float64 0
100
⌀ | markers
float64 124
383
⌀ | 5s_rrna
stringclasses 2
values | 16s_rrna
stringclasses 1
value | 23s_rrna
stringclasses 1
value | trnas
float64 14
20
⌀ | draft_quality
stringclasses 2
values | start_position
int64 0
10M
| autotrain_text
stringlengths 150
150
| autotrain_label
class label 2
classes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,388,650 | TTGAACCGAGGAGGTGGAGGTTGCAATGAGCTGAGATCATGCCATTGCACTCCAGCCTGGGTGACAAGAGCAAGACTCTGTCTCAAAAAAAAAAAAAAAAAAGACCGAGACATAGGAGACACCTGTCAAAGATGTTTGTGAAGATCCACC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,528,200 | TCCCTCAGAGTAGATCCGGTGCTCATTAGAAGTCATCCTCACTCCCCAGTCCTCTCTCCCACAGCCTCTGACAAACCCTATTTGACCTTCTACCTCTATGGATTTACCTATAATGGATGTTTCATGTAAATGGAATCATATAACATAATG | 11
|
G000010625 | ASM1062v1 | GCF_000010625.1 | PRJNA224116 | SAMD00060936 | null | 2008/01/24 | Kazusa DNA Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/625/GCF_000010625.1_ASM1062v1 | 641,522,640 | RS_GCF_000010625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 449,447 | 1,126 | Microcystis aeruginosa NIES-843 | strain=NIES-843 | null | Bacteria | Cyanobacteria | null | Chroococcales | Microcystaceae | Microcystis | Microcystis aeruginosa | true | Microcystis aeruginosa NIES-843 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 5,842,795 | 1 | 42.33 | 5,842,795 | 1 | 5,605 | 1,591,543 | 80.239081 | 99.89 | 0.51 | 25 | 350 | yes | yes | yes | 20 | high | 4,191,850 | GCAGGAGATAACAACCATAAAAACTGGCACAATTTAAGCCTGATAAGGGACGAATCACCTTGGCCGCCAGATTATCTAAGCCATAATCGCCGACAATTGCCCAGAGTAGGTGCTTAACCGTCGTCGTACCTTGGTAGGGGGAACAATGTT | 0no label
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Sinorhizobium meliloti 1021 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 6,690,970 | GCCGTACCCATGATTTCACCGTATTCCATCGCCGCTTCTTCCGTCAGACCGTATATCCGGTCGGCGAAGCGCTGCCGCCAACCATCGAGGCCATGCTGCAGACGGCCGGCGCGCTGATCCGGCACAATTTTCTGGATGCCATAGGCGATT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,881,800 | GTCTCGACATGAGACACAGGAGGTCCAGGTGAAGATGAAGGCAGAGACGGGAGCAGCCTCCCGTCAAACCTTCGGGAGCATGGCCCTGCCCACCGCTGGTCTCCAGCCTGAGGAAACTGCTTCCGGTTGTCACCTGCCACCTGGTTTGTG | 11
|
G000008185 | ASM818v1 | GCF_000008185.1 | PRJNA57583 | SAMN02603967 | null | 2004/02/03 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/185/GCF_000008185.1_ASM818v1 | 637,000,327 | RS_GCF_000008185.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,275 | 158 | Treponema denticola ATCC 35405 | strain=ATCC 35405 | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Spirochaetaceae | Treponema | Treponema denticola | true | Treponema denticola ATCC 35405 | Eubacteria | Spirochaetes | 1 | 1 | 1 | 1 | 2,843,201 | 1 | 37.87 | 2,843,201 | 1 | 2,578 | 885,778 | 91.799314 | 100 | 0 | 0 | 281 | yes | yes | yes | 20 | high | 371,410 | TGTTTCTTGCCGAAATTCTATATGACAAAGAATATGAGACTCTTTTTTGGAAACTTGAAAATCAAGCTCATAAGTTTATAAACGAAAATCTGGAACATTTGTTTAAAGAAGGGACTTTTGAAGGTAAAAAAATAAAGTATAAAACAAACA | 0no label
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Pseudomonas putida KT2440 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 2,124,460 | TCAATGCGCATCGTGAAGGCGACCCGGTGACAGCGGGATTGGAGCTTATTAAGCATGTCTATAATCATGGCAATATCAAAGGCAAGCTATCTTGTGTGGTCATTCGTGTGCCGGCGGGCGAAGTAGGGTCTAGTGCGCGTAAATAGTCTC | 0no label
|
G000010665 | ASM1066v1 | GCF_000010665.1 | PRJNA224116 | SAMD00060954 | null | 2009/06/11 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/665/GCF_000010665.1_ASM1066v1 | 644,736,352 | RS_GCF_000010665.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 573,370 | 184,917 | Desulfovibrio magneticus RS-1 | strain=RS-1 | null | Bacteria | Proteobacteria | Deltaproteobacteria | Desulfovibrionales | Desulfovibrionaceae | Desulfovibrio | Desulfovibrio magneticus | true | Desulfovibrio magneticus RS-1 | Eubacteria | Proteobacteria | 0.99 | 0.996 | 1 | 1 | 5,315,620 | 3 | 62.67 | 5,248,049 | 1 | 4,555 | 1,546,858 | 85.744052 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 1,077,440 | GAAACGATGGTGTCGGATCGCAGGATCCTGTGAATTTTTAGCACCATAATCCCGCTACCGTGACTGAAATTGTCCGGTCCCTAGCAGCCCGTTGAAAAACGCGATTTTCAGTCATTTTTAGGCGTCTAAGATGTTGAAATTGCAGGGCCG | 0no label
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 4,746,170 | CCGCCGCCGTGGTTGTGCATGTCCACGAAGCCGGGGACCACCCAGTGGCCGCTGAGGTCGATGGTCCGGGCGTCCTCCGGTGCGGAGGCGGAGATGCGGGTGGACTCGATGGTCACCCGGCCGTCCTCGACGGTGCCGCTGGGGAGCACC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,840,600 | ACTGGACATTTGCCCAGAGGGAGCTTCTGGAAAAACAAGGAATTGATATGAAACAAGAGATGGAGAAAAGGTAATGCACAGTTACGCAGCCCATATGACTGTTTCTTCTTTTAAACATGTAATACTAATAGCATTCTTGAATTTTTTTTT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,738,900 | CAGCAAGCCTCTATAGAACTTGATCCCTGTTAAAATGCATCACTGACTGTCCATCAAACTTACATAAAAAAACCAACAACGGGGCATGAGAGGTTATCAGGTTCTGACTACTTCCTAATATCCTTTTAATTATAAAATATTTATTTACTT | 11
|
G000007385 | ASM738v1 | GCF_000007385.1 | PRJNA224116 | SAMN02603680 | null | 2005/02/02 | NIAB, Rural Development Administration | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/385/GCF_000007385.1_ASM738v1 | 637,000,346 | GB_GCA_000007385.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 291,331 | 347 | Xanthomonas oryzae pv. oryzae KACC 10331 | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas oryzae | true | Xanthomonas oryzae pv. oryzae KACC 10331 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,941,439 | 1 | 63.69 | 4,941,439 | 1 | 4,831 | 1,427,680 | 85.113992 | 99.82 | 0 | 0 | 355 | yes | yes | yes | 20 | high | 3,912,090 | AGCACCGGACCAGGACCGGCCGGCCTCTGCAACGACGCCGCTCTCCACATATCGCTTGCACCCGCCGCACGCGCACTGCCTAGTTCCACTGTGTTACAAATAATCGTACCTTTGTGCCACTATTGGAAGACCTTCAGGCCGCGCGGGAGA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,027,300 | AGCTATGATCGTGCCACTGCACTCCAGCCTGGGCAGCAGAGAAAGACCCCATCTGAAAAAATAAAATAAGGCTGGGTGTGGTGGCTCATGCCTGTAATCACAGAACTTTGGGAGGCCCAAAAGTTGGCCCTCGCCTTCGCCTCATGCACG | 11
|
G000006725 | ASM672v1 | GCF_000006725.1 | PRJNA224116 | SAMN02603773 | null | 2004/06/04 | Sao Paulo state (Brazil) Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/725/GCF_000006725.1_ASM672v1 | 637,000,348 | RS_GCF_000006725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 160,492 | 2,371 | Xylella fastidiosa 9a5c | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xylella | Xylella fastidiosa | true | Xylella fastidiosa 9a5c | Eubacteria | Proteobacteria | 0.98 | 0.993 | 0.9 | 1 | 2,731,750 | 3 | 52.62 | 2,679,306 | 1 | 2,664 | 765,931 | 82.59299 | 99.59 | 0.18 | 0 | 325 | yes | yes | yes | 20 | high | 2,145,520 | CAGGCAACCTAGTCCTCCTCGATTCCTGGCCGGGTCAAATGCGTACCGTCTACGGTGACCACCAACGTTTTATAGACACTTACTTTCGCACCTACCCCAATACTTACTTCACCGGCGACGGCTGCCGCCGCGATGCCGACGGCTACTACT | 0no label
|
G000010985 | ASM1098v1 | GCF_000010985.1 | PRJNA224116 | SAMD00060965 | null | 2010/03/05 | Japan Agency for Marine-Earth Science and Technology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/985/GCF_000010985.1_ASM1098v1 | 646,564,525 | RS_GCF_000010985.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 639,282 | 197,162 | Deferribacter desulfuricans SSM1 | strain=SSM1 | null | Bacteria | Deferribacteres | Deferribacteres | Deferribacterales | Deferribacteraceae | Deferribacter | Deferribacter desulfuricans | true | Deferribacter desulfuricans SSM1 | Eubacteria | Bacteria | 1 | 0.996 | 1 | 1 | 2,542,933 | 2 | 30.31 | 2,234,389 | 1 | 2,468 | 805,380 | 93.314963 | 96.55 | 1.72 | 0 | 345 | yes | yes | yes | 20 | high | 996,320 | AAGATAGATGAAACAGATTTTCATAATATTGGAACGGTTGACGAAAAATTGGTTAAACTTGCAAAAAAGTATAAGGGTAAAATTATCACAACTGATCATAATTTATTGAAAGTTGCAGAAATTCAGAATGTGGAAGTTTTGAATATAAAT | 0no label
|
G000007525 | ASM752v1 | GCF_000007525.1 | PRJNA57939 | SAMN02603675 | null | 2005/01/21 | Nestle Research Center, Switzerland | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/525/GCF_000007525.1_ASM752v1 | 637,000,031 | RS_GCF_000007525.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 206,672 | 216,816 | Bifidobacterium longum NCC2705 | strain=NCC2705 | null | Bacteria | Actinobacteria | Actinobacteria | Bifidobacteriales | Bifidobacteriaceae | Bifidobacterium | Bifidobacterium longum | true | Bifidobacterium longum NCC2705 | Eubacteria | Actinobacteria | 1 | 0.996 | 0.9 | 1 | 2,260,266 | 2 | 60.13 | 2,256,640 | 1 | 1,833 | 667,063 | 86.967994 | 100 | 0 | 0 | 289 | yes | yes | yes | 20 | high | 1,124,630 | GGGTCTCGTAGGAATCCGATATGACCTGGAACAGGAGCCTGGATCCCTCCTCGTCGATCGGCATGTAGCCGAACTCGTCGATGATCAGGAGCCTGGCCTTGGCGATCTGCCGGAGCTCCGTGTCGAGCCGGTCCTCCCGCTTCGCGCGGC | 0no label
|
G000009245 | ASM924v1 | GCF_000009245.1 | PRJNA224116 | SAMEA3138197 | null | 2006/03/02 | LLNL | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/245/GCF_000009245.1_ASM924v1 | 637,000,111 | RS_GCF_000009245.1 | Monoisolate | Complete Genome | Full | na | Major | 376,619 | 263 | Francisella tularensis subsp. holarctica LVS | strain=LVS | null | Bacteria | Proteobacteria | Gammaproteobacteria | Thiotrichales | Francisellaceae | Francisella | Francisella tularensis | true | Francisella tularensis subsp. holarctica LVS ASM924v1 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 1,895,994 | 1 | 32.15 | 1,895,994 | 1 | 2,100 | 571,581 | 88.799806 | 99.82 | 0.41 | 100 | 311 | yes | yes | yes | 20 | high | 443,430 | AAATGGTAACATCCTCCATTGACAGCCTGTACGTAACACATAAAATACAGCTTCAATAAATAATCTTAATTTGGCTTCATCATTGGTATGTATACCTTTTTATGATTTTAAAAATGATAAAATAATTGACCAGAATACTTCTTTTATATG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,982,850 | CTAGTTTATCCTCCTCATGGCATCTACCTGAATTCATCTTATTTAAGTTAATTTGCTTATTTGTCTGTGGTCCCTATTAGAATGCAAATCCCATGAGAACAGTACCTCCACGGTTATTTCTATTCCCAGAGTTGAGAAGGTGCCTCGTAC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,749,800 | GCACCGCCGCGACTGCAGGGAGCTCAGCGCAGGGTACCAGAGCCAGCATCGGGGGCGTTGGTGGGCGGTCCTGTCCAAGCAGGCCTCCTGACCCCAGCCCAGGGCTCCTCCCTGCCGCTGCCCTGCAGGCCCAGTCCGAGGGGCTGGGGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,580,150 | CGCCCTTGGCAAACTTTAAATTGCCCTATAAAACTTAAAATGTGGCACTGTTAGCACCTTTCTGGTAGTGGAATTCATACATTAGATTGTTTCTCAAGCTTTTTTGACTCTCACCCACAGTAAAAAATACAGAAATACATTTTCCACTGC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,946,150 | CACTACCACACCACCACACTACCACACCACCACACTACACCACACAACACCACACTACCACAACACCACACTACCACAACACCACACTACCACAACACCACACGACCACACCACCACACTACACCACACAACACCACACTACCACAACAC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,653,200 | GGCCTCCTGGTCCTGAGATATCTCTGTGCCTCCTGCGTAGCTTAGCTTCCCAGTTGCCTTTGTCTCTGGGTACAACAAATTGAGTCAGTGTCTGTCCCCTCGCTGGGCATGGGGGCAGGGCCCTGGGGCACACTCTGTACCCCCATCTGG | 11
|
G000007825 | ASM782v1 | GCF_000007825.1 | PRJNA57975 | SAMN02603340 | null | 2004/07/06 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/825/GCF_000007825.1_ASM782v1 | 637,000,017 | RS_GCF_000007825.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,900 | 1,396 | Bacillus cereus ATCC 14579 | strain=ATCC 14579 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus cereus | true | Bacillus cereus ATCC 14579 | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,427,083 | 2 | 35.29 | 5,411,809 | 1 | 5,541 | 1,546,426 | 83.933929 | 98.18 | 0.58 | 18.18 | 383 | yes | yes | yes | 20 | high | 2,827,110 | GTCTTATAAGGAAATTAAACCCTTCTTCTTCACTGTCTTGAACGAGATGACTGAATTCATATTCCATTAAATTTTCTATTTGTTGAATATGTATATCTTTCAAGTCCATTCCCCCTAAGTACGAAAATACATAAAAATGCTCGAGAATCA | 0no label
|
G000007925 | ASM792v1 | GCF_000007925.1 | PRJNA57995 | SAMN02603142 | null | 2003/07/25 | CNRS | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/925/GCF_000007925.1_ASM792v1 | 637,000,213 | RS_GCF_000007925.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 167,539 | 1,219 | Prochlorococcus marinus subsp. marinus str. CCMP1375 | strain=CCMP1375; SS120 | null | Bacteria | Cyanobacteria | null | Synechococcales | Prochloraceae | Prochlorococcus | Prochlorococcus marinus | true | Prochlorococcus marinus subsp. marinus str. CCMP1375 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 1,751,080 | 1 | 36.44 | 1,751,080 | 1 | 1,908 | 529,797 | 89.120257 | 100 | 0 | 0 | 312 | yes | yes | yes | 20 | high | 186,680 | GCATTGGGTAAGGATGCGGCCCAGCAACAGATCCGAGAATATAGTGAGTAGTCTCTACATTGGTAACCCAATCTCGAATAGCTTCACTTGTTGCATCTTTCAACGTTGCTGTCCCAGCCGTTACAGGTCGAACTTTTGCTCCAAGTAATT | 0no label
|
G000009825 | ASM982v1 | GCF_000009825.1 | PRJNA224116 | SAMD00061074 | null | 2004/12/30 | Kao Corporation, Biological Science Laboratories, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/825/GCF_000009825.1_ASM982v1 | 637,000,019 | RS_GCF_000009825.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 66,692 | 79,880 | Bacillus clausii KSM-K16 | strain=KSM-K16 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus clausii | true | Bacillus clausii KSM-K16 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 4,303,871 | 1 | 44.75 | 4,303,871 | 1 | 4,304 | 1,270,194 | 86.940919 | 98.67 | 0.33 | 0 | 373 | yes | yes | yes | 20 | high | 4,234,880 | GGCGCAAAGCAGCACCACCTTTCTTTATGGGCTTGGGGACTTGCCTGAACAGACACGCGCTGGCGCCGATGCGAAACAAGTCGAGGAAACGTTCGGGCAATCAACGCCGATTGTCTTGCTCGTCCCTAATGACGACATCGCTAAAGAAGA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,921,150 | GATGTGGCCTTTTGAGTCTGGCTTCTTTCGCCAGACATAATGATCCTGAGATTTATCCATGTAGTTGCATGTATCAGTACTTCCTTCCTTTTTATGGGTGAGTGGTGTTCCATGGTGTGGATATACAGCAATTTGTTTAACCATTCACCT | 11
|
G000006845 | ASM684v1 | GCF_000006845.1 | PRJNA57611 | SAMN02604088 | null | 2005/02/14 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/845/GCF_000006845.1_ASM684v1 | 637,000,188 | RS_GCF_000006845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 242,231 | 485 | Neisseria gonorrhoeae FA 1090 | strain=FA 1090 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Neisseriaceae | Neisseria | Neisseria gonorrhoeae | true | Neisseria gonorrhoeae FA 1090 | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 2,153,922 | 1 | 52.69 | 2,153,922 | 1 | 2,142 | 609,210 | 83.31778 | 99.82 | 0.21 | 0 | 323 | yes | yes | yes | 20 | high | 1,192,100 | GTGGCGATGGATTTGTTCAGCCAGGCCGAACACGACGAAATTGCCCAAGCCATCCTCATCGGCACGTCGCAAGCGTATCTCGACGAAGTAGAAGCCGCTATGGACAGGCTCATCGAAACCATGCCGCGCCGCGACATCATCGAGGCCTCG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,319,950 | CAACCTCCACCTCCTGGGTTCAAGCAATTCTCCTGCCTCAGCCTCCAACTAGCTGGGATTACTGACACCTGCCACCACACCTGACTGATTTTTGTATTTTTACTAGAGACAGGGGTTCACCATGTTGCCTAGGCTGGTCTCGAACTCCTG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,142,350 | CCTTTTGTTTCTGTGATTCCGCCTGGAAGCCTCTCCTTCAAACACATTCCCTTTTCTCTCCCCTTAATAGGAATACTCCCCCAGTTGCAAGAGGCGCAGGACCGTGGAAGACTTCAACAAATTCTGCACCTTTGTCTTGGCCTATGCTGG | 11
|
G000010625 | ASM1062v1 | GCF_000010625.1 | PRJNA224116 | SAMD00060936 | null | 2008/01/24 | Kazusa DNA Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/625/GCF_000010625.1_ASM1062v1 | 641,522,640 | RS_GCF_000010625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 449,447 | 1,126 | Microcystis aeruginosa NIES-843 | strain=NIES-843 | null | Bacteria | Cyanobacteria | null | Chroococcales | Microcystaceae | Microcystis | Microcystis aeruginosa | true | Microcystis aeruginosa NIES-843 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 5,842,795 | 1 | 42.33 | 5,842,795 | 1 | 5,605 | 1,591,543 | 80.239081 | 99.89 | 0.51 | 25 | 350 | yes | yes | yes | 20 | high | 1,953,380 | CAATGGTTAGAAAAAGGCATTTATATCGTGCATCTCACGGGAGAAAACGACCCCGAAGCGGATAGTTTGCGCCATTCTAACTATTTTTCCCAGCCTTTTTACGACAATATGGCAGGATTATGGCAAAGAGCTAATCTGGCTATCAGTCGC | 0no label
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Pseudomonas putida KT2440 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 1,705,860 | AGTTCCGCGACCTGAGTGCGCTGTCGGCCTGGATGTGCTTCTCCAACTTCCTCAACCACCTGAGCCTGGATCGCATTGAAGCCGACTACGCGAACATTCTCTGAGCACTGCCGCCTGCTCGTCCTCGGCCTGGCCCTGCTGAGCCTTGGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,816,700 | GCCGCCCACCCGCCGGCTGCACCTCACAGCCGCTCCTCCCCAGCCTGCTGGTGTCTGACGTTGGCATCCCCTCTGTGGGATACATCAGGAGCCCATCCGGATCCGGGGCCGGCAGGTTGGGTTCCCGGGATGGGTTGGGAGTTCCCAGAA | 11
|
G000010625 | ASM1062v1 | GCF_000010625.1 | PRJNA224116 | SAMD00060936 | null | 2008/01/24 | Kazusa DNA Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/625/GCF_000010625.1_ASM1062v1 | 641,522,640 | RS_GCF_000010625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 449,447 | 1,126 | Microcystis aeruginosa NIES-843 | strain=NIES-843 | null | Bacteria | Cyanobacteria | null | Chroococcales | Microcystaceae | Microcystis | Microcystis aeruginosa | true | Microcystis aeruginosa NIES-843 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 5,842,795 | 1 | 42.33 | 5,842,795 | 1 | 5,605 | 1,591,543 | 80.239081 | 99.89 | 0.51 | 25 | 350 | yes | yes | yes | 20 | high | 4,182,490 | CCCAAAGATTCCGGCATTGTACCGTGAGTATATTGAGAATCGTATTCGGTCTTTTCCAGATCATAATTTTGTATTACTATAATTCCATGAATATGATTGGGCATGACAATAAAAGCATCTAGTTCAATAAATTTAAAATTTAGAGGTAGT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,019,750 | AACATCTTAAGAAAACAGAACAGGAAGAACGATTTCCCAACTAATTTTTTGAGGGAGTATTACTCTGATATGAAAACCAAAGTTCTTATTACCAAACTCCTTATTACAAAGAAGGAAGACTACAACTCAGTATCTCTCATGATCACAAAT | 11
|
G000007265 | ASM726v1 | GCF_000007265.1 | PRJNA57943 | SAMN02604013 | null | 2002/08/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/265/GCF_000007265.1_ASM726v1 | 637,000,285 | RS_GCF_000007265.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 208,435 | 1,311 | Streptococcus agalactiae 2603V/R | strain=2603V/R | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus agalactiae | true | Streptococcus agalactiae 2603V/R | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,160,267 | 1 | 35.65 | 2,160,267 | 1 | 2,106 | 643,747 | 87.791509 | 100 | 0.18 | 0 | 298 | yes | yes | yes | 20 | high | 2,152,020 | CAATTGTTGGTTTCCTAGCTTTTGACAGTGATACGGTTATGTTTTCTATTATTGGGTTGATAACTATTAGTTATATTATTAATGCTATCCAAACTGGATTTACAACCTTAAGCACTGTCTTAATCGTTTCTCAAGAGCACCAAAAAATTA | 0no label
|
G000009125 | ASM912v1 | GCF_000009125.1 | PRJNA224116 | SAMEA3138192 | null | 2003/05/06 | Genoscope | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/125/GCF_000009125.1_ASM912v1 | 637,000,231 | RS_GCF_000009125.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 267,608 | 305 | Ralstonia solanacearum GMI1000 | strain=GMI1000 | null | Bacteria | Proteobacteria | Betaproteobacteria | Burkholderiales | Burkholderiaceae | Ralstonia | Ralstonia solanacearum | true | Ralstonia solanacearum GMI1000 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 5,810,922 | 2 | 66.98 | 3,716,413 | 1 | 5,062 | 1,725,241 | 87.482692 | 99.94 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 2,849,340 | GCCCACTTGGGCACCAGGTTCGAGTTGGCGATCAGCACGCGCGGCGCGTCCGGGTGCGTCTTGAACACGCCGACCGGCTTGCCGGACTGCACCAGCAGCGATTCGTCGTCGTTCAGCTCGCGCAGCGTCTCCAGGATCTTGTCGAAGCAG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,367,700 | CACATCATGAGACAAAGAAACAAAGTCTGTGCTTTCCAAGATGGCACACAAGTACAAGAACTTTTTGTTTTAGACTCTTGATTTTTTTGCCCCTTCTAAAAAGAGCTAAGGGAAATCTCTTTCTTCCATACACCTCATTAAAACATCATA | 11
|
G000007345 | ASM734v1 | GCF_000007345.1 | PRJNA224116 | SAMN03081414 | null | 2002/04/03 | Broad Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/345/GCF_000007345.1_ASM734v1 | 638,154,508 | RS_GCF_000007345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 188,937 | 2,214 | Methanosarcina acetivorans C2A | strain=C2A | null | Archaea | Euryarchaeota | Methanomicrobia | Methanosarcinales | Methanosarcinaceae | Methanosarcina | Methanosarcina acetivorans | true | Methanosarcina acetivorans C2A | Archaea | Euryarchaeota | 0.98 | 1 | 0.8 | 0.9 | 5,751,492 | 1 | 42.68 | 5,751,492 | 1 | 4,884 | 1,470,904 | 75.340086 | 99.84 | 0.03 | 0 | 229 | no | yes | yes | 18 | medium | 1,416,090 | AGTTTTTATGTATAAAGTAATTATTTTTCCGGACCTTTCTTTCCCCTTAAATGTTTCAACAATATATTCAATTCTTATATAGGACTTACGCGGTTGAACCGAGTAATCAATGGCATTAAACCTTCAACGGTATAAGACAATAACCAGGTT | 0no label
|
G000009025 | ASM902v1 | GCF_000009025.1 | PRJNA224116 | SAMEA3138187 | null | 2005/08/19 | Max Planck Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/025/GCF_000009025.1_ASM902v1 | 637,000,090 | RS_GCF_000009025.1 | Monoisolate | Complete Genome | Full | na | Major | 255,470 | 61,435 | Dehalococcoides mccartyi CBDB1 | strain=CBDB1 | null | Bacteria | Chloroflexi | Dehalococcoidia | Dehalococcoidales | Dehalococcoidaceae | Dehalococcoides | Dehalococcoides mccartyi | true | Dehalococcoides mccartyi CBDB1 | Eubacteria | Chloroflexi | 0.97 | 1 | 1 | 1 | 1,395,502 | 1 | 47.03 | 1,395,502 | 1 | 1,437 | 426,285 | 89.985038 | 99.01 | 0 | 0 | 259 | yes | yes | yes | 20 | high | 89,180 | AATTAGAGCAGATAGCAATGACCTTGGATAATGAGTGTTCTAACACTCTTGCTCGTCTCAGAGGTAAGAGATGATTGAGACTTATCTCGAGGCTGCAATACGCCAAGCTCAAGAGCGAGCCAAACTCTTGAAAGCAAAGATGCCTCAACC | 0no label
|
G000010585 | ASM1058v1 | GCF_000010585.1 | PRJNA224116 | SAMD00060930 | null | 2009/01/28 | Juntendo University School of Medicine | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/585/GCF_000010585.1_ASM1058v1 | 643,348,562 | RS_GCF_000010585.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 458,233 | 69,966 | Macrococcus caseolyticus JCSC5402 | strain=JCSC5402 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Macrococcus | Macrococcus caseolyticus | true | Macrococcus caseolyticus JCSC5402 | Eubacteria | Firmicutes | 1 | 0.965 | 1 | 1 | 2,219,737 | 9 | 36.56 | 2,102,324 | 1 | 2,352 | 677,409 | 89.896055 | 96.13 | 1.1 | 0 | 339 | yes | yes | yes | 20 | high | 1,883,960 | TAGAATCCTTCTTTCCTTCTAAATTACCGCTTATCAACTTTAGAATGAATAATCGAAATCACCGCAAGATTGTCGTAATCGACGGTAAAATTGGCTATATCGGCGGTTTTAATGTAGGTGATGAATACCTGGGTCTGGATAAGAAATTTG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,293,200 | GGATCGTCTTTATTTTCTATAGTTATGGGCAAAATAGAAGTTTTAAATTTTAGTTTAATCAGATGTATTAAATTTTTCTTTATTGATTCCCTGTTTTGTATCTTAAGAAGCCCACCTGTACATAGAAATCTTAATGACATTCTCAGATAT | 11
|
G000007865 | ASM786v1 | GCF_000007865.1 | PRJNA224116 | SAMN02604086 | null | 2004/01/30 | Univ. Minnesota | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/865/GCF_000007865.1_ASM786v1 | 637,000,168 | RS_GCF_000007865.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 262,316 | 1,764 | Mycobacterium avium subsp. paratuberculosis K-10 | strain=K-10 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Mycobacteriaceae | Mycobacterium | Mycobacterium avium | true | Mycobacterium avium subsp. paratuberculosis K-10 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 4,829,781 | 1 | 69.3 | 4,829,781 | 1 | 4,544 | 1,497,326 | 91.345322 | 99.28 | 0.33 | 0 | 336 | yes | yes | yes | 20 | high | 3,596,320 | CGGGCACGCCGGGGGCCACCTGGATGGCGGCCACCGGCGACGAGCAGCCCGGCACCGCCGCCTACGGGATCGCGCTGCTGTCCCGGTATCCGGTGGCCAGCTGGCAGGTGCTGCGGTTACCCCGCATTCCGATGCGATTTCCGATGTACC | 0no label
|
G000008185 | ASM818v1 | GCF_000008185.1 | PRJNA57583 | SAMN02603967 | null | 2004/02/03 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/185/GCF_000008185.1_ASM818v1 | 637,000,327 | RS_GCF_000008185.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,275 | 158 | Treponema denticola ATCC 35405 | strain=ATCC 35405 | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Spirochaetaceae | Treponema | Treponema denticola | true | Treponema denticola ATCC 35405 | Eubacteria | Spirochaetes | 1 | 1 | 1 | 1 | 2,843,201 | 1 | 37.87 | 2,843,201 | 1 | 2,578 | 885,778 | 91.799314 | 100 | 0 | 0 | 281 | yes | yes | yes | 20 | high | 480,740 | CGGGCGGTATACTCATGCTGATTGCCGTTATTCCGGTTATTATTTCCGCTATTGTAATATGTTTTTTTGTGCAGCCATATAGGAGAATGATAAAAGAAAAGGCCGTAATAGATGCCGAAAAATATTCGGGTATGGTAGAGTCCATAAACG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 200,850 | ACCATCTTAGGTTACAGCCACCTCTGGGTCAATTCCCAACATTCAAAAGCTGAGCAGGGCTTTAAAGCTATCTTATTAATAATTATTTCTGTATTGCGAACTTCAGCATACTTTTTTCTAGTTACATTTGAAATGTTATTCTTTTGGGAT | 11
|
G000006605 | ASM660v1 | GCF_000006605.1 | PRJNA224116 | SAMEA3283089 | null | 2005/06/27 | Bielefeld Univ | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/605/GCF_000006605.1_ASM660v1 | 637,000,085 | RS_GCF_000006605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 306,537 | 38,289 | Corynebacterium jeikeium K411 | strain=K411 = NCTC 11915 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Corynebacteriaceae | Corynebacterium | Corynebacterium jeikeium | true | Corynebacterium jeikeium K411 K411 = NCTC 11915 | Eubacteria | Actinobacteria | 1 | 0.996 | 1 | 1 | 2,476,822 | 2 | 61.35 | 2,462,499 | 1 | 2,137 | 751,284 | 89.378688 | 100 | 0.68 | 0 | 319 | yes | yes | yes | 20 | high | 1,425,970 | TCAGCTTTTCCACGTTCTCGCCCGGCGCGAGCGCCATGCCGGTGCGCTTGGTGGCGTCATTGCGCCGAAGAGCCATGACCAGCTGCAGCTCGAGCGCCTCGTTGAACTTCAGCCTGCGCCGGGCGGGTTCGGGGCCGGCTTCGCTCGGCT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,519,050 | CAAACAAAATATTCGGCAAGAGAGTGGCAACATTTTTGCATCTGGTTGAGCAGAACACGGTTGAGCCATCACACCTGCCTCTGCGTTCAGGCTGCTGCAGTGTTGGGTTAAGATTGTGAGGAAATCCAGTGTGTGAGGAGGCTTGGGGTG | 11
|
G000009065 | ASM906v1 | GCF_000009065.1 | PRJNA57621 | SAMEA1705942 | null | 2003/05/06 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/065/GCF_000009065.1_ASM906v1 | 637,000,351 | RS_GCF_000009065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 214,092 | 632 | Yersinia pestis CO92 | strain=CO92 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia pestis | true | Yersinia pestis CO92 ASM906v1 | Eubacteria | Proteobacteria | 1 | 0.994 | 1 | 1 | 4,829,855 | 4 | 47.64 | 4,653,728 | 1 | 4,298 | 1,371,586 | 83.669593 | 99.82 | 0 | 0 | 372 | yes | yes | yes | 20 | high | 2,570,620 | AACTCGAGCCATCGGCATCACATAAGCCCCAAGTGACAGCGGATGCCCTCGCGCCAGTAGAGCCAATAACCGCATCGGTTCCCCCACCAATCATGCAGCCACTATTACCGTTGGATCACGCCCCGGTCCCGCCCGACGCCAAAGTAGCTG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,417,500 | CTGTAACTGTAACACATTATTTTGAATGAGTAGTACTTGCTTTCTGAACGATGTAGACCAATCAGTCTCCGTGGTACATTTTTCATTAAAAGGCAGCTCACAGATGAGCTTACGGGAGCGGGTTCTGCCAGGTGGAAGTGAAACCGATGG | 11
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Pseudomonas putida KT2440 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 5,562,180 | GTGATACCGGTGCGGTAGTTGTCGAGGAAGCGCTGCAGGCGTTCGCGGATATCCACGGCCATCTGCTCACGACCCTCGGTCAACACCTGGTCCATCGAAGTGGAACCCACCACGTGGCGCAGGGCGCTGTCGGTCGCGTGCTGCAAGCTC | 0no label
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Pseudomonas putida KT2440 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 4,933,760 | TCTTGCCCATGCCCGCCGGGCCGACCATGGCGATCACCCCACCCTCTTCGATCGGCTCGATTTCAGGCACTTCGATCATCCGTGCCAAGTGAGCCAGCAGCATGCGCCAGGCCTGGCGCGGCTCTTCGATCTCGGCGGTCAGGTCCAGCA | 0no label
|
G000008345 | ASM834v1 | GCF_000008345.1 | PRJNA224116 | SAMN02603281 | null | 2004/07/30 | Goettingen Genomics Laboratory | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/345/GCF_000008345.1_ASM834v1 | 637,000,215 | RS_GCF_000008345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 267,747 | 1,747 | Propionibacterium acnes KPA171202 | strain=KPA171202 | null | Bacteria | Actinobacteria | Actinobacteria | Propionibacteriales | Propionibacteriaceae | Cutibacterium | Cutibacterium acnes | true | Propionibacterium acnes KPA171202 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 2,560,265 | 1 | 60.01 | 2,560,265 | 1 | 2,373 | 780,330 | 89.799572 | 100 | 0 | 0 | 319 | yes | yes | yes | 20 | high | 729,430 | CCACACCACCTTGGGAGCGGGCACCGACTTCCGTCGCGACGCCATCAACGTCCTGGAACAGATGGGTATTTCGGTAGAGTTCAGCCACCACGAGGCCGCTCCTGGACAGCACGAAATTGACCTTCGTTACGCCGATGCGCTGACGATGGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,109,750 | TAAATAATTGTTTTCTTCATAAATTACCCAGTCTCAGGCATTTTGTTATAGCAGCACAAATGAGCTGAGACAGTGTTGTACAGTCCTTCTCTTTTCTACTTTTGTTCCCTCTTCTCTTGGAAGCAAGTCCCCTACTTCCAGGAACATGCA | 11
|
G000007385 | ASM738v1 | GCF_000007385.1 | PRJNA224116 | SAMN02603680 | null | 2005/02/02 | NIAB, Rural Development Administration | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/385/GCF_000007385.1_ASM738v1 | 637,000,346 | GB_GCA_000007385.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 291,331 | 347 | Xanthomonas oryzae pv. oryzae KACC 10331 | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas oryzae | true | Xanthomonas oryzae pv. oryzae KACC 10331 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,941,439 | 1 | 63.69 | 4,941,439 | 1 | 4,831 | 1,427,680 | 85.113992 | 99.82 | 0 | 0 | 355 | yes | yes | yes | 20 | high | 3,717,740 | TCCGTGCCGGCCTTGTCGCCCAGAGCGGCTGCAAGTGCGGCGTTCTCGGGGTCGAATTCTGCGCCAAGACCAGGGTAGTAAAAAGCGCGCGCACCGTTTGCCGGATCTTCACGTAATGCTGCATGAATTTTCGCAATGTTACTTGCAGGA | 0no label
|
G000009985 | ASM998v1 | GCF_000009985.1 | PRJNA224116 | SAMD00061077 | null | 2005/12/01 | Tokyo University of Agriculture and Technology, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/985/GCF_000009985.1_ASM998v1 | 637,000,155 | RS_GCF_000009985.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,108 | 84,159 | Magnetospirillum magneticum AMB-1 | strain=AMB-1 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Rhodospirillaceae | Magnetospirillum | Magnetospirillum magneticum | true | Magnetospirillum magneticum AMB-1 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,967,148 | 1 | 65.09 | 4,967,148 | 1 | 4,628 | 1,522,305 | 90.298759 | 99 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 1,738,620 | AGGCGAAGATCACCCTGGTGCGCGTGGCCGATCGGCCGGGCGTCGCGGCCTCCATCTTCGGCCCGCTGGCCGAGGCGGCGGTCAACGTGGACATGATCGTCCAGAACGTGTCCGAGGACGGCAAGTCCACCGACCTGACCTTCACCGTCG | 0no label
|
G000009965 | ASM996v1 | GCF_000009965.1 | PRJNA224116 | SAMD00061071 | null | 2005/01/05 | Kyoto University, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/965/GCF_000009965.1_ASM996v1 | 638,154,520 | RS_GCF_000009965.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 69,014 | 311,400 | Thermococcus kodakarensis KOD1 | strain=KOD1 | null | Archaea | Euryarchaeota | Thermococci | Thermococcales | Thermococcaceae | Thermococcus | Thermococcus kodakarensis | true | Thermococcus kodakarensis KOD1 | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 0.9 | 2,088,737 | 1 | 52 | 2,088,737 | 1 | 2,314 | 650,473 | 91.73242 | 100 | 0 | 0 | 190 | no | yes | yes | 19 | medium | 650,260 | GCTCAGCGAAATCGGAGATATAAGGGTTGCCAAGGTTATTCTCAACCAGTACGCGCCCCAGGGGCTTATCGAGGCAGTCTCAAATCAGGGCTTCGAGCCGATCATAGTCTCCGGCGAGACAGGTGTAAAACTCGCCGTCGAGGCCATGAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,742,950 | TGGCTTCACAGAGATTTATTGTTTTACAGCTATGGAGGCAGGTAGTCTAAGATTAAGATGTGGGCAGGCTGGTTCCTTCTGAGGCTGTGAGGGACCCTCTAGCCCTCTGTCTCAGGCCTGTCCCCTGGTTTCTGGGGGTTGCTTGCAATT | 11
|
G000007185 | ASM718v1 | GCA_000007185.1 | PRJNA294 | SAMN02603235 | null | 2002/04/03 | Fidelity Systems | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/007/185/GCA_000007185.1_ASM718v1 | 638,154,507 | GB_GCA_000007185.1 | Monoisolate | Complete Genome | Full | na | Major | 190,192 | 2,320 | Methanopyrus kandleri AV19 | strain=AV19 | null | Archaea | Euryarchaeota | Methanopyri | Methanopyrales | Methanopyraceae | Methanopyrus | Methanopyrus kandleri | true | Methanopyrus kandleri AV19 | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 1 | 1,694,969 | 1 | 61.16 | 1,694,969 | 1 | 1,814 | 523,004 | 90.896353 | 96.74 | 1.6 | 0 | 146 | yes | yes | yes | 15 | medium | 127,790 | TAACGATTCCCGGCGCAGCCAGGTTGGCTCCGTGGCAGATGGCGTCGACGGCCGTATCCCTGATCTCTATTCTCGGTAGGTGCTCGAGACCTTCCTCCATCGGTCGTACAACGTGTCGTAAGGGCTCTTCCCATCCCTCCTCCTTCCAGA | 0no label
|
G000009065 | ASM906v1 | GCF_000009065.1 | PRJNA57621 | SAMEA1705942 | null | 2003/05/06 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/065/GCF_000009065.1_ASM906v1 | 637,000,351 | RS_GCF_000009065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 214,092 | 632 | Yersinia pestis CO92 | strain=CO92 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia pestis | true | Yersinia pestis CO92 ASM906v1 | Eubacteria | Proteobacteria | 1 | 0.994 | 1 | 1 | 4,829,855 | 4 | 47.64 | 4,653,728 | 1 | 4,298 | 1,371,586 | 83.669593 | 99.82 | 0 | 0 | 372 | yes | yes | yes | 20 | high | 2,093,260 | CCAAGGATGGCGCGGCTCGAGCCTACATGGATGTATTTACGGCGTCTTTACGATCTGCCTGTTCTCTCCGTCGCGGGCACTTTGTCAATAACCTCAACCACTGATTCAGTGGTTTTTGGTGGCAAAATTTAATATGTTTTGGCCTTTTAA | 0no label
|
G000009245 | ASM924v1 | GCF_000009245.1 | PRJNA224116 | SAMEA3138197 | null | 2006/03/02 | LLNL | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/245/GCF_000009245.1_ASM924v1 | 637,000,111 | RS_GCF_000009245.1 | Monoisolate | Complete Genome | Full | na | Major | 376,619 | 263 | Francisella tularensis subsp. holarctica LVS | strain=LVS | null | Bacteria | Proteobacteria | Gammaproteobacteria | Thiotrichales | Francisellaceae | Francisella | Francisella tularensis | true | Francisella tularensis subsp. holarctica LVS ASM924v1 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 1,895,994 | 1 | 32.15 | 1,895,994 | 1 | 2,100 | 571,581 | 88.799806 | 99.82 | 0.41 | 100 | 311 | yes | yes | yes | 20 | high | 1,399,190 | ACGAACATATCCTTGTGCTAATATCTTATCTAATAAAGTATGATGTGTACCTTTTTTTTGAGAAATAATTGGTGCTAGTATCATCAATCTTGAATCTTCATCAAATTCCAAAATTTTATCAACCATTTGGCTGATAGTTTGAGCCTTCAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,964,300 | CAATGAATACGTAAAGGAATTCTAAGTTTTAGAACAGTGATACTTTATTTTTCTTTGTTTGTTTGTTTGTTTTTGTTTCTTTTGAGCCGGAGTCTCACCGTCGGTCAGGCTGAAGTCCAGTGGTGCCAGCTCGACTCACTGCAACCTCCA | 11
|
G000008685 | ASM868v2 | GCF_000008685.2 | PRJNA57581 | SAMN02603966 | null | 2011/11/09 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/685/GCF_000008685.2_ASM868v2 | 637,000,036 | RS_GCF_000008685.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 224,326 | 139 | Borrelia burgdorferi B31 | strain=B31 | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Borreliaceae | Borreliella | Borreliella burgdorferi | true | Borrelia burgdorferi B31 | Eubacteria | Spirochaetes | 1 | 0.879 | 1 | 0.9 | 1,521,208 | 22 | 28.18 | 910,724 | 1 | 1,511 | 441,681 | 85.52361 | 100 | 0 | 0 | 178 | yes | yes | yes | 20 | high | 360,230 | TGCTTAGTAAGATCATTAAAAAACATTCTTGCTATTGGATTGGGTTTTTGCCCAACAGAAATAGGGAAATAATCTGGATCCCCACTAACATATCTTATTAGATATAAAATTTCTTTACTCTTATTTATATCCAAAATAGAAGAAATAACC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,518,000 | CCACCTCAGCCTTCTTTGGTCAAGTAGTGAAAAGGACTAGTCTGACTGGAGTTCTCTCTTCATTTCCTTGCCTATTTGCTGATGGAGACAGGGTGCTCATGAGAGATCGGGGGAAGAAAAGCAAAGAACCTGGTGTTGCCTCTTTGGGGT | 11
|
G000005825 | ASM582v2 | GCF_000005825.2 | PRJNA224116 | SAMN02603086 | null | 2010/12/15 | Center for Genomic Sciences, Allegheny-Singer Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/005/825/GCF_000005825.2_ASM582v2 | 646,311,908 | RS_GCF_000005825.2 | Monoisolate | Complete Genome | Full | representative genome | Major | 398,511 | 79,885 | Bacillus pseudofirmus OF4 | strain=OF4 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus pseudofirmus | true | Bacillus pseudofirmus OF4 | Eubacteria | Firmicutes | 1 | 0.995 | 1 | 1 | 4,249,248 | 3 | 39.86 | 3,858,997 | 1 | 4,260 | 1,228,222 | 85.144124 | 98.68 | 1.32 | 0 | 377 | yes | yes | yes | 20 | high | 4,124,120 | AGAGCAAATATTGCTATATCAGTAGTTTTAAAGCGATTAAATGGAGATATATATAATCTTGGTTATTTTTTGAAGTCTCTTTTAGATAAGTTGGAAGACAATGACTTGTTTCATGTATATAAAGTAATTAGTGAAGAATTAAAGTATACA | 0no label
|
G000007325 | ASM732v1 | GCF_000007325.1 | PRJNA57885 | SAMN02603417 | null | 2002/04/09 | Integrated Genomics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/325/GCF_000007325.1_ASM732v1 | 637,000,117 | RS_GCF_000007325.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 190,304 | 851 | Fusobacterium nucleatum subsp. nucleatum ATCC 25586 | strain=ATCC 25586 | null | Bacteria | Fusobacteria | Fusobacteriia | Fusobacteriales | Fusobacteriaceae | Fusobacterium | Fusobacterium nucleatum | true | Fusobacterium nucleatum subsp. nucleatum ATCC 25586 | Eubacteria | Bacteria | 1 | 1 | 1 | 1 | 2,174,500 | 1 | 27.15 | 2,174,500 | 1 | 2,022 | 670,780 | 90.88917 | 99.95 | 0 | 0 | 297 | yes | yes | yes | 20 | high | 2,167,490 | AACCACCTGAAACTATAAGTTTAAATGCCCATTCAACAGTCATATTAAGTGGATGAATATCTTCCCTTGGCACACATAATAAGAAACCAGAAGTTGGATTAGGTGCTGTTGGTACAAACACATTAACAATTTCTTTATCTTCTAAAAATT | 0no label
|
G000009365 | ASM936v1 | GCF_000009365.1 | PRJNA224116 | SAMEA3138202 | null | 2006/07/24 | German Research Centre for Biotechnology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/365/GCF_000009365.1_ASM936v1 | 637,000,004 | RS_GCF_000009365.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 393,595 | 59,754 | Alcanivorax borkumensis SK2 | strain=SK2 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Oceanospirillales | Alcanivoracaceae | Alcanivorax | Alcanivorax borkumensis | true | Alcanivorax borkumensis SK2 | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,120,143 | 1 | 54.73 | 3,120,143 | 1 | 2,820 | 929,045 | 87.73194 | 100 | 0 | 0 | 352 | yes | yes | yes | 20 | high | 1,361,360 | GGTTGCGTCTCTGTGCCGAGGTAATGTTCGTCGTCGCGGCGCGAATAGTCATCAGCGTGCGGCTGGGCCAGTATGCGATGGACGGGCTCCTGCGCTTCGCAGTTATCGGGCGGCATTCTATCGTTGTCCCTGTCTGGACGCTATGCCAGT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,669,250 | TGTCCTCACGGCGGCCTACGAAGCAGGTGCTGTTTTTCTCCTGCTGCATAGATGCTGCTACAAGGCCCAGAGACCTCAAGGCACTTGCTCGAGTACGCACGGTGGACACTGTCCAGTAAGGCTGAACACGCACCCTCCAACTGCCCTCCA | 11
|
G000007385 | ASM738v1 | GCF_000007385.1 | PRJNA224116 | SAMN02603680 | null | 2005/02/02 | NIAB, Rural Development Administration | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/385/GCF_000007385.1_ASM738v1 | 637,000,346 | GB_GCA_000007385.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 291,331 | 347 | Xanthomonas oryzae pv. oryzae KACC 10331 | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas oryzae | true | Xanthomonas oryzae pv. oryzae KACC 10331 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,941,439 | 1 | 63.69 | 4,941,439 | 1 | 4,831 | 1,427,680 | 85.113992 | 99.82 | 0 | 0 | 355 | yes | yes | yes | 20 | high | 3,677,700 | CAGCACGCGGCGTGGGTGCCAGCGCAAGCCGGTGCTGGAAACCCAAGGCCTGCAGCTCATCGCGCAGGCGGCGCTCGAAGCGTGGCCAAGGGCCGAACAAGCGAAAGCTGGCACCGGCTTCCAGCACGATGGCGCGCGACCACTGCTGGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,321,500 | GAACTGGAAGATACATAAGTATAAATTACCCATTTGAGACCCAGAAAGAAAAAAGACTAAAAAAAAAAAAAAAAAAAAAAGGACAAAGCCTTAGTGATTTTTAGAGCAAAATCAAGCAGTGTCACATATGTGTTATTGGAAGCCCAGAAA | 11
|
G000011005 | ASM1100v1 | GCA_000011005.1 | PRJDA20361 | SAMD00060931 | null | 2009/12/25 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/011/005/GCA_000011005.1_ASM1100v1 | 2,505,679,075 | GB_GCA_000011005.1 | Monoisolate | Complete Genome | Full | na | Major | 304,371 | 570,267 | Methanocella paludicola SANAE | strain=SANAE | null | Archaea | Euryarchaeota | Methanomicrobia | Methanocellales | Methanocellaceae | Methanocella | Methanocella paludicola | true | Methanocella paludicola SANAE | Archaea | Euryarchaeota | 1 | 1 | 0.8 | 0.9 | 2,957,635 | 1 | 54.92 | 2,957,635 | 1 | 3,055 | 877,570 | 87.405714 | 100 | 0.65 | 0 | 198 | no | yes | yes | 17 | medium | 2,083,900 | TACAGGATGCCGGAGCGCAAAGACGACTTCAAGCATGCAAAAAGGGTTGAGGATAACATCGTAGTTGACGGCAACATCGTAACGGCAAAGGCCGTAGGATACGTGGATCTAGCGCTCGAGCTGGGCAGGATCTTTAACATATACAGAGAT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,518,700 | GCCTACAAGAAGAAAGGACTCATTCCTGCCTATCACCGGGTCATCATGGCAGAACTTGCTACCAAGAATTCTAAATGGGTGGAAGTTGATACATGGGAAAGTCTTCAGAAGGAGTGGAAAGAGACTCTGAAGGTGCTAAGGTATTTATGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,755,750 | ACCAGCCTGGCCAACATGGTGAAACACCATCTCTACTAAAGATAGAAAAAATGAGCCAGACATGGTGGGGCATGTCTGCAATCCCAGCTACTCGGGAAGCTGAGGCAAGAGAATCGCTTGAACCCAGGAAGCGGAAGTTGCAGTGAGCCA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,780,900 | AGTGAATGATCTAACCGCTTACATTTATGGTTAGGTTATTTGTGTAAACCTGGAGACATTAAACCTGTATAAATGCACTCAAAAACAGGAAGTAGATAAAATTGGTTTTCACTTATAATATGAGGTACACTCCATCAAGTGACTGAACTG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,853,950 | ATAACCAGTGATCTGGAATGGGGGCTTGGTAAGCATTTTCTGTAAAACACTAGATAGTAAATATTTTAGACTTAGTGGACCATGTGGTCTTTTTTGTGAAACTGTTCAACTCTATTGTTGTAGTACGAAAGCAGCCATAGACAATATGGA | 11
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 8,503,560 | GCGCATCGTCACCCCCTCACAACAGGTACGACGCCTCTTCGGGATCTCCGGCGTTGACAGCGTCCTGGAGATCCGGCAGACGATCGAGGAAACCGTCGCCCCTTAACCCATACCGGCCAGCCGGGGGTTCGGGGTGCCGGTGGAGGCGAC | 0no label
|
G000007385 | ASM738v1 | GCF_000007385.1 | PRJNA224116 | SAMN02603680 | null | 2005/02/02 | NIAB, Rural Development Administration | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/385/GCF_000007385.1_ASM738v1 | 637,000,346 | GB_GCA_000007385.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 291,331 | 347 | Xanthomonas oryzae pv. oryzae KACC 10331 | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas oryzae | true | Xanthomonas oryzae pv. oryzae KACC 10331 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,941,439 | 1 | 63.69 | 4,941,439 | 1 | 4,831 | 1,427,680 | 85.113992 | 99.82 | 0 | 0 | 355 | yes | yes | yes | 20 | high | 2,007,980 | CTGGGCGCTGAGTGAATCCGTGCCGTCCGGGCGATGCGTCCGGATGAGGCCGATGCGCACGCTACAATGGCCGCATGCACGACAGCGCTGCTTCCAGCCCCGACCCACGCCCGATCGCCCCACAGCCGCCTGCGCCCAACGAATGCTGCG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,506,550 | ATCTTACTATGTTGTCCGGGCTGGCCTCCTGGGCTCAAGCACCCACCTCAGCCTCCTGAGTTGCTGGGATCGCAGGCACATGCCACCAGGCCTGGCTATGGGGTCATTATAAGAAGAGAAAACAGACACAGGTACCCAGAGGAGGCCACA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,579,350 | AGTTCCCGTAAGGAGAGCAACAGCTGCTATGGAATAGCCAAGCCCTGCTCCACCAGGAAGGGGCCTGAGCTTTGGCAAGGATACACTTAGCCTGACCAATCCAGAGACTCAGCCTCCACTACCAGTGGGATGACGGATTTCCCAGTCGTA | 11
|
G000008165 | ASM816v1 | GCF_000008165.1 | PRJNA58091 | SAMN02598266 | null | 2004/06/24 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/165/GCF_000008165.1_ASM816v1 | 637,000,015 | RS_GCF_000008165.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 260,799 | 1,392 | Bacillus anthracis str. Sterne | strain=Sterne | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Bacillus anthracis str. Sterne ASM816v1 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,228,663 | 1 | 35.38 | 5,228,663 | 1 | 5,471 | 1,495,624 | 84.251844 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 3,894,800 | GTGCACTACAAATATGGGGAAATCCCTCTCATGAGGTGAAATTATGAGTATTCAAGTATTTTGTGATTTCGATGGCACGATTACAAATAATGATAACATTATGTCCATTATGGAGAAATTCGCACCACCAGAAGCTGAAGAAGTAAAGAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,422,050 | CAACATGAAGAAGCAACCAGGTAAGCCCGGAACACGGGACGTTCTGCAAGACAGCTCACTTGGTCTCTCCTGAAAGCCAGTGTCACTGGAAAAGAATGCAGGCGACTACGAGATTAAAGTGATAATTACAAATACAATACAGGAAACCGG | 11
|
G000006925 | ASM692v2 | GCF_000006925.2 | PRJNA62907 | SAMN02603599 | null | 2011/08/03 | Microbial Genome Center of ChMPH | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/925/GCF_000006925.2_ASM692v2 | 637,000,264 | RS_GCF_000006925.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 198,214 | 623 | Shigella flexneri 2a str. 301 | strain=301 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Enterobacteriaceae | Shigella | Shigella flexneri | true | Shigella flexneri 2a str. 301 | Eubacteria | Proteobacteria | 1 | 0.998 | 1 | 1 | 4,828,820 | 2 | 50.65 | 4,607,202 | 1 | 5,003 | 1,415,151 | 86.329724 | 99.7 | 0.21 | 0 | 372 | yes | yes | yes | 20 | high | 611,520 | GCAAGCGTATACCGCTCTGGCGATGGCGTCTGCCAGTTGTGCTTCTTTCGCCGCCTGGTTGTACAACATGCCGTGCGGTTTGACATGACGCATTACGCCGCCTTGCGCACGGGCAATCGTTGCCAGCGCGCCAATTTGATACAGCGTCTG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,799,050 | CAACATCAAATGATCTAACAGACATATAATTGGAGGCCCAGACCATGAGGAGTGGGTGGCAGAAAAATAGTTGAAGAACAGGTGGTCAAGACTTTTCCAAATGTGATGAAACTAAAGAGTCACAGATCCTAGAAGCAGGAGAAATACAAA | 11
|
G000010585 | ASM1058v1 | GCF_000010585.1 | PRJNA224116 | SAMD00060930 | null | 2009/01/28 | Juntendo University School of Medicine | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/585/GCF_000010585.1_ASM1058v1 | 643,348,562 | RS_GCF_000010585.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 458,233 | 69,966 | Macrococcus caseolyticus JCSC5402 | strain=JCSC5402 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Macrococcus | Macrococcus caseolyticus | true | Macrococcus caseolyticus JCSC5402 | Eubacteria | Firmicutes | 1 | 0.965 | 1 | 1 | 2,219,737 | 9 | 36.56 | 2,102,324 | 1 | 2,352 | 677,409 | 89.896055 | 96.13 | 1.1 | 0 | 339 | yes | yes | yes | 20 | high | 1,864,720 | CTGTTCCTTTGTAACTCCGTGCTGAGTGTCCTACAACCCCAGGATGCAAGCACCCTGGTTTGGGCTCTTCCCGTTTCGCTCGCCGCTACTAAGGGAATCGAATTTTCTTTCTCTTCCTCCGGGTACTTAGATGTTTCAGTTCTCCGGGTG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,426,150 | CCGGAGCCTCACTGGGGAGATGGACATGAACAGCAAATGCACAGCGAGGTTGGTCCCCGCACCTGAGACCACACTGAGGCTGAAGGAGGGGCTGGCAGTGCTAGGGCAGGGCTGCGGCTCTCAGCATCCTGATGTGAAATTGTCTCCGGC | 11
|
G000010085 | ASM1008v1 | GCF_000010085.1 | PRJNA224116 | SAMD00061079 | null | 2006/01/10 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/085/GCF_000010085.1_ASM1008v1 | 637,000,270 | RS_GCF_000010085.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 343,509 | 63,612 | Sodalis glossinidius str. 'morsitans' | strain=morsitans | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Pectobacteriaceae | Sodalis | Sodalis glossinidius | true | Sodalis glossinidius str. 'morsitans' morsitans | Eubacteria | Proteobacteria | 1 | 0.993 | 1 | 1 | 4,292,502 | 4 | 54.5 | 4,171,146 | 1 | 5,742 | 1,142,020 | 78.310831 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 333,190 | ATCAGTTCGGCGGCTATACCGGCATGACGCCGGCGCAATTTCGCGATGCGGTCTGGCATCAGGCGAATGAATGCGGGTTGCCGCGGTACAGGGTCTGGCTAGGGGGGGATCACCTGGGTCCTAACGCTTGGCAGGATCGACCGGTGGCGG | 0no label
|
G000010305 | ASM1030v1 | GCF_000010305.1 | PRJNA224116 | SAMD00060909 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/305/GCF_000010305.1_ASM1030v1 | 643,692,024 | RS_GCF_000010305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 379,066 | 173,480 | Gemmatimonas aurantiaca T-27 | strain=T-27 | null | Bacteria | Gemmatimonadetes | Gemmatimonadetes | Gemmatimonadales | Gemmatimonadaceae | Gemmatimonas | Gemmatimonas aurantiaca | true | Gemmatimonas aurantiaca T-27 | Eubacteria | FCB | 1 | 1 | 1 | 1 | 4,636,964 | 1 | 64.27 | 4,636,964 | 1 | 4,004 | 1,466,180 | 93.177023 | 98.9 | 4.4 | 0 | 353 | yes | yes | yes | 20 | high | 4,546,360 | CCCGGCTTCCGCGAAGCCCGCCGCATGGAGCAGGAAGTGCGCTCCTATGGCGCCATGGGTACCGCGCATCCGGTCGCCATTCCCGGCGTGCGTCCGCTCGATGGCGCCATCTCGAGCGCCGTGGATCGCCTGAACCGTCCGCTCGACCTC | 0no label
|
G000008385 | ASM838v1 | GCF_000008385.1 | PRJNA224116 | SAMN02603678 | null | 2005/02/02 | New England Biolabs, Inc. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/385/GCF_000008385.1_ASM838v1 | 637,000,340 | RS_GCF_000008385.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 292,805 | 80,849 | Wolbachia endosymbiont strain TRS of Brugia malayi | null | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rickettsiales | Anaplasmataceae | Wolbachia | Wolbachia endosymbiont of Brugia malayi | true | Wolbachia endosymbiont strain TRS of Brugia malayi | Eubacteria | Proteobacteria | 0.96 | 1 | 0.9 | 1 | 1,080,084 | 1 | 34.18 | 1,080,084 | 1 | 1,140 | 271,320 | 73.973691 | 99.15 | 0 | 0 | 223 | yes | yes | yes | 20 | high | 495,170 | AAAGCAAAATACTAAACTACCTGCCATGAAAAACAACGCCAACAGAGGAAAAGTAAAAAAGAAAGTATACAACCAGATCGTTTAGAGAAATTTTTGGTCGAAGCTGGCATTATTGCAATAAGAATTAGTGTTATTGCAGTTGGTTTTCTC | 0no label
|
G000008565 | ASM856v1 | GCF_000008565.1 | PRJNA57665 | SAMN02603976 | null | 2000/12/11 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/565/GCF_000008565.1_ASM856v1 | 637,000,092 | RS_GCF_000008565.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,230 | 1,299 | Deinococcus radiodurans R1 | strain=R1 | null | Bacteria | Deinococcus-Thermus | Deinococci | Deinococcales | Deinococcaceae | Deinococcus | Deinococcus radiodurans | true | Deinococcus radiodurans R1 ASM856v1 | Eubacteria | Terrabacteria | 1 | 0.991 | 0.8 | 1 | 3,284,156 | 4 | 66.61 | 2,648,638 | 1 | 3,248 | 987,980 | 88.625967 | 98.72 | 0 | 0 | 359 | yes | yes | yes | 20 | high | 254,800 | AGCGATGGTCGTAGGTCAGGCTGAGCGGCAGCATGTTGCGCGGCTCGAACTCGCCCTTTTCCTTGTTCCACACCGGCTCAAAGCCGCCACGGGAGACGCCGAGGATGGCGACTTCGGGGCTGTTGACGATGGGTGTAAAAGCGTTCCCAC | 0no label
|
G000007985 | ASM798v2 | GCF_000007985.2 | PRJNA57743 | SAMN02603989 | null | 2012/07/31 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/985/GCF_000007985.2_ASM798v2 | 637,000,120 | RS_GCF_000007985.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,231 | 35,554 | Geobacter sulfurreducens PCA | strain=PCA | null | Bacteria | Proteobacteria | Deltaproteobacteria | Desulfuromonadales | Geobacteraceae | Geobacter | Geobacter sulfurreducens | true | Geobacter sulfurreducens PCA | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,814,128 | 1 | 60.94 | 3,814,128 | 1 | 3,417 | 1,176,369 | 90.878544 | 99.35 | 0 | 0 | 363 | yes | yes | yes | 20 | high | 2,065,830 | AATCTTGGCGGCCATCAGGATGCTGTCCACGTCGACCCCGAGAGACTTGGCAATTTGTTTGTACTTGCGGGTCTCCAAGTCGTGGAGGTGATTGCGGAGGATGCCGTCCACAACGCTCCCCGCCATGCCGAGCTGCTCCACCTGGATCAG | 0no label
|
G000008185 | ASM818v1 | GCF_000008185.1 | PRJNA57583 | SAMN02603967 | null | 2004/02/03 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/185/GCF_000008185.1_ASM818v1 | 637,000,327 | RS_GCF_000008185.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,275 | 158 | Treponema denticola ATCC 35405 | strain=ATCC 35405 | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Spirochaetaceae | Treponema | Treponema denticola | true | Treponema denticola ATCC 35405 | Eubacteria | Spirochaetes | 1 | 1 | 1 | 1 | 2,843,201 | 1 | 37.87 | 2,843,201 | 1 | 2,578 | 885,778 | 91.799314 | 100 | 0 | 0 | 281 | yes | yes | yes | 20 | high | 2,101,190 | CCGTATCATTGACAACTGCTGACGAAACATTAAGATCAGAGCTTATGCCTATCACTAAAACAAACAGCCTTGACGAATTAAAGCAAGCAATAAAATACTTTAATTCAAAATCAAATAAGAGAGTAACCTTAGAGCTCGCCCTTATGAAGG | 0no label
|
G000009065 | ASM906v1 | GCF_000009065.1 | PRJNA57621 | SAMEA1705942 | null | 2003/05/06 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/065/GCF_000009065.1_ASM906v1 | 637,000,351 | RS_GCF_000009065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 214,092 | 632 | Yersinia pestis CO92 | strain=CO92 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia pestis | true | Yersinia pestis CO92 ASM906v1 | Eubacteria | Proteobacteria | 1 | 0.994 | 1 | 1 | 4,829,855 | 4 | 47.64 | 4,653,728 | 1 | 4,298 | 1,371,586 | 83.669593 | 99.82 | 0 | 0 | 372 | yes | yes | yes | 20 | high | 3,934,970 | TCACCACCACATCAATATCTTGTGCTGTCAGTGCGTTAACACATAGCTCACTATTCTTCAGACAAGAGAGCTGCAATGACAGATAAAATTGCCCAGCTTTGACCGTGACGCCGGGCATTTGATACTGAATGCCCGTTAAGGTGAGACCAC | 0no label
|
G000008925 | ASM892v1 | GCF_000008925.1 | PRJNA58233 | SAMN02604111 | null | 2006/03/30 | University College Cork | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/925/GCF_000008925.1_ASM892v1 | 637,000,143 | RS_GCF_000008925.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 362,948 | 1,624 | Lactobacillus salivarius UCC118 | strain=UCC118 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Lactobacillaceae | Lactobacillus | Lactobacillus salivarius | true | Lactobacillus salivarius UCC118 | Eubacteria | Firmicutes | 1 | 0.986 | 1 | 1 | 2,133,977 | 4 | 33.04 | 1,827,111 | 1 | 2,106 | 630,045 | 86.976336 | 99.48 | 0.52 | 0 | 292 | yes | yes | yes | 20 | high | 1,719,770 | GTAAATACTGGTTTAACACCTTTTGCTTCCAATGCATCTAGCACATCGTTGCCAAATACATATTGTTCCATTAATGGAGTTGCACCCATACCATTAATTAAAACAGCATATTTCTTATCCTTATCTAAATGAAGTTCTTCATCAAGTTTT | 0no label
|
G000007925 | ASM792v1 | GCF_000007925.1 | PRJNA57995 | SAMN02603142 | null | 2003/07/25 | CNRS | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/925/GCF_000007925.1_ASM792v1 | 637,000,213 | RS_GCF_000007925.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 167,539 | 1,219 | Prochlorococcus marinus subsp. marinus str. CCMP1375 | strain=CCMP1375; SS120 | null | Bacteria | Cyanobacteria | null | Synechococcales | Prochloraceae | Prochlorococcus | Prochlorococcus marinus | true | Prochlorococcus marinus subsp. marinus str. CCMP1375 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 1,751,080 | 1 | 36.44 | 1,751,080 | 1 | 1,908 | 529,797 | 89.120257 | 100 | 0 | 0 | 312 | yes | yes | yes | 20 | high | 786,110 | CCTTTATAACTCTTTCTCTCCAGAGTTGGCTTACTTCCAGTACATTTGCTTTGTCGATAGAACATATCTTTTTTCTTCTAGTTTCTGATAAATCAAATGCTATTTTAGCGATTCTGTCTATTTCATAATCTGAATAAGTCATAGTATTAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,186,300 | AACTCTTCTAGAGCAGAAACATCCAATCCTGCAAAGCCCAAAGATGCCGTTCTAGAATATAACTAAGATAGCTCAAAAACTCACATTTTCTGAGGGTGCCCTCTGTGTCAGGTACAGTTATAAACATTTTACATATATTAATTCATTTAA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,406,100 | TTGGGTTTGTCATGTGACTCTCTTTGGCCATGGGAACATAGGCAAAAATGACTTGTGCCCCTTCTGAGCCCCGGCCTTGAGAGGTCTTCATGCTTGCATTTGCCACTGCAGTGAGAAGAGCTTTCCGTAGATAACTGCTGCCCCCACAGT | 11
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Sinorhizobium meliloti 1021 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 3,755,960 | TCTTTCTGTTTCAGAACCTCTTCCTGCAGCTTGTGCTTGGTCTGTCACCATTGGAAGCTGCACTTTGGTCTGCGCCATCGGCCCTAGTCTTCGCTGTCATGTCTTTCCAGGCCTACCGCTTCACCAACCGCTTCGGACCCGTCAGAACAG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,366,400 | CCTGGCAGTTTGACTTGCCTCTTGGCGCTCCGGCCATCCTTAGGAAGAGGCCCTGGGAGGCTGTGGGTCCAGGGTGAGACTCTCACAGAGCCAGATGGACCCTGACCTGCAGCTGGAAGCCGAGCCTCCATAGCCACCCTCAGGATCGTG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,182,950 | GCACCCATACGCCCAGATGAGCATCTGACAGCCTGGAACAGCACCCTGCACCCCCAGGCGAGCATCTGACAGCCTGGAACAGCACCCATACGCCCAGATGAGCATCTGACAGCCTGGAACAGCACCCTGCACCCCCAGGTGCGCACCTGA | 11
|
G000005825 | ASM582v2 | GCF_000005825.2 | PRJNA224116 | SAMN02603086 | null | 2010/12/15 | Center for Genomic Sciences, Allegheny-Singer Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/005/825/GCF_000005825.2_ASM582v2 | 646,311,908 | RS_GCF_000005825.2 | Monoisolate | Complete Genome | Full | representative genome | Major | 398,511 | 79,885 | Bacillus pseudofirmus OF4 | strain=OF4 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus pseudofirmus | true | Bacillus pseudofirmus OF4 | Eubacteria | Firmicutes | 1 | 0.995 | 1 | 1 | 4,249,248 | 3 | 39.86 | 3,858,997 | 1 | 4,260 | 1,228,222 | 85.144124 | 98.68 | 1.32 | 0 | 377 | yes | yes | yes | 20 | high | 3,611,270 | TACTTCTGCGGACCCATTCCATTTATGAGAGTGATGAAGCAGTATTTAGCTGAAATGGGCGTGAGCGACGAGCGCGTATATTATGAGTTCTTTGGACCAGCGGCGAGTTTGGATGCTGTGGTTGAGGCGAAATAAAGATTGATAGAGGAG | 0no label
|
G000009065 | ASM906v1 | GCF_000009065.1 | PRJNA57621 | SAMEA1705942 | null | 2003/05/06 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/065/GCF_000009065.1_ASM906v1 | 637,000,351 | RS_GCF_000009065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 214,092 | 632 | Yersinia pestis CO92 | strain=CO92 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia pestis | true | Yersinia pestis CO92 ASM906v1 | Eubacteria | Proteobacteria | 1 | 0.994 | 1 | 1 | 4,829,855 | 4 | 47.64 | 4,653,728 | 1 | 4,298 | 1,371,586 | 83.669593 | 99.82 | 0 | 0 | 372 | yes | yes | yes | 20 | high | 448,890 | CAGCTTGGCATTACGCAGTGGGTATTGCGCCGTCCTGCCGTCTTGCAGGGTGAGATTGCAATACATTTACCTGAAGATACCCGCCTACTGATTGTGGCACAGCAACTGCCTGAACACGGTGATCCACTGTTGTGCGATGTGCTACGCAGT | 0no label
|
G000007145 | ASM714v1 | GCF_000007145.1 | PRJNA57887 | SAMN02603845 | null | 2002/05/24 | Sao Paulo state (Brazil) Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/145/GCF_000007145.1_ASM714v1 | 637,000,344 | RS_GCF_000007145.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 190,485 | 339 | Xanthomonas campestris pv. campestris str. ATCC 33913 | strain=ATCC 33913 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas campestris | true | Xanthomonas campestris pv. campestris str. ATCC 33913 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 5,076,188 | 1 | 65.07 | 5,076,188 | 1 | 4,292 | 1,472,146 | 85.453159 | 99.64 | 0 | 0 | 358 | yes | yes | yes | 20 | high | 3,507,400 | GCCGTCGCACCCGCACCCGCTGCCTGACATCTCTTGCGCCACGCGGCCAGCGCTCAGTTGCATCCGCAGACGTCTTCGTCTACCGCATCCACCACGGCGCGGCGATCCCCGACACACCACTGCGCAACACCGCCCGCATGACACCGGCCC | 0no label
|