#genome
stringclasses 121
values | asm_name
stringclasses 120
values | assembly_accession
stringclasses 120
values | bioproject
stringclasses 45
values | biosample
stringclasses 120
values | wgs_master
float64 | seq_rel_date
stringclasses 98
values | submitter
stringclasses 76
values | ftp_path
stringclasses 120
values | img_id
float64 637M
2.51B
⌀ | gtdb_id
stringclasses 120
values | scope
stringclasses 3
values | assembly_level
stringclasses 1
value | genome_rep
stringclasses 1
value | refseq_category
stringclasses 3
values | release_type
stringclasses 2
values | taxid
float64 1.15k
681k
⌀ | species_taxid
float64 7
911k
⌀ | organism_name
stringclasses 120
values | infraspecific_name
stringclasses 112
values | isolate
stringclasses 1
value | superkingdom
stringclasses 2
values | phylum
stringclasses 18
values | class
stringclasses 30
values | order
stringclasses 56
values | family
stringclasses 75
values | genus
stringclasses 89
values | species
stringclasses 117
values | classified
bool 1
class | lv1_group
stringclasses 2
values | lv2_group
stringclasses 13
values | score_faa
float64 0.93
1
⌀ | score_fna
float64 0.88
1
⌀ | score_rrna
float64 0.1
1
⌀ | score_trna
float64 0.6
1
⌀ | total_length
float64 618k
9.12M
⌀ | contigs
float64 1
22
⌀ | gc
float64 22.5
72.2
⌀ | n50
float64 616k
9.03M
⌀ | l50
float64 1
1
⌀ | proteins
float64 525
7.92k
⌀ | protein_length
float64 172k
2.68M
⌀ | coding_density
float64 74
96.9
⌀ | completeness
float64 76.3
100
⌀ | contamination
float64 0
4.4
⌀ | strain_heterogeneity
float64 0
100
⌀ | markers
float64 124
383
⌀ | 5s_rrna
stringclasses 2
values | 16s_rrna
stringclasses 1
value | 23s_rrna
stringclasses 1
value | trnas
float64 14
20
⌀ | draft_quality
stringclasses 2
values | start_position
int64 0
10M
| human_label
int64 0
1
| autotrain_text
stringlengths 150
150
| autotrain_label
class label 121
classes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,049,650 | 1 | AAAACATTGATGGTGATGGATTGTCTTAAAATTCTTTGCAAGGCCAGCACAGTAAAACATCATATGAATGAGCCAGATTTCAACATAAATAAGGGGCAACTAAGAAGCTAGACTCAATTGTCTCAAAGGTATCAAAACTAATCACCATAG | 120homo sapiens
|
G000009945 | ASM994v1 | GCF_000009945.1 | PRJNA224116 | SAMD00061108 | null | 2006/03/09 | Japanese Consortium/Yamaguchi Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/945/GCF_000009945.1_ASM994v1 | 637,000,067 | RS_GCF_000009945.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 264,202 | 83,556 | Chlamydia felis Fe/C-56 | strain=Fe/C-56 | null | Bacteria | Chlamydiae | Chlamydiia | Chlamydiales | Chlamydiaceae | Chlamydia | Chlamydia felis | true | Eubacteria | Chlamydiae | 1 | 0.992 | 1 | 1 | 1,173,791 | 2 | 39.34 | 1,166,239 | 1 | 994 | 361,027 | 90.6353 | 99.49 | 0 | 0 | 223 | yes | yes | yes | 20 | high | 52,520 | 0 | ATTGTAATGATACATGCTTTCCCTGAAGACATGCTGAGCTTCTTTTTGATCTCAGGATGATTTTTTAAATAATGAATAAAGGGATCATGGGAATTTTTTGTTTTTATATTTCCATCCCTTAAGGGGATGAGACAAAGCGAAAAGTCCGTG | 21Chlamydia felis Fe/C-56
|
G000009305 | ASM930v1 | GCF_000009305.1 | PRJNA224116 | SAMEA3138199 | null | 2006/06/28 | Penn State Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/305/GCF_000009305.1_ASM930v1 | 637,000,130 | RS_GCF_000009305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 382,638 | 212 | Helicobacter acinonychis str. Sheeba | strain=Sheeba | null | Bacteria | Proteobacteria | Epsilonproteobacteria | Campylobacterales | Helicobacteraceae | Helicobacter | Helicobacter acinonychis | true | Eubacteria | Proteobacteria | 1 | 0.994 | 0.9 | 1 | 1,557,588 | 2 | 38.17 | 1,553,927 | 1 | 1,547 | 470,618 | 89.011857 | 99.12 | 0.7 | 100 | 271 | yes | yes | yes | 20 | high | 762,450 | 0 | CGTTTGGTTTTGCTATCGTTATAGTCTTGCTCTTGATTGTTATTCTTAAGAGTGAGATACCCATGCCCGAATCGCAATAACAAGCGGTGGTTTTTGGTTTCTAAAGGAAAACTCTTTTTTAAGATCTTTTGAAAGGAATTTTTCTTCTCA | 46Helicobacter acinonychis str. Sheeba
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,298,250 | 1 | GCCTAACATGGTGTGGGTCCCTGTCTCCAAAGACTATATTTCTCACGCGTGGCCCACGTGCAGCTTTAATTTCAGCAGTAGAGTGCATGAGCCAATTCAGTGAAATGTCACAGGCCAGGCAAAAAGGTTAAAGATCAGACAGACAGCTGA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,803,300 | 1 | GCAAGACGACGATATGCTGTCTACAAAAAGTACACTTTAAAAACATAGGCAGGTTAAAAGTAAAAGGATGGATAGAGCTACACCATGCTAATGCTAGTCAAAAGAAATAAAAAGTGACCATATTAATATCACAGAAAGTAGATGTAAGAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 170,700 | 1 | TCACCTCCAGCTCTGTGGCCCTGTGGTTGGAGAACGCTGCTCAAGTGCATTTGAAAGGAACCATCCCACGCCATTCTTCAGAGTCATCTTTACTGCTGCAGTGGTCAACTTGTAGCACCCCTAAGCTCGCAGGACATATGCTTCAACTGG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,756,150 | 1 | CAATTTGTTCATAAATACATTCTCATAACTTCTCAGGTTGAACTATGTAAAAAATTTTGGGATGGGTGTGGTGGCTCATGCCTTGTAATCCCAACACTTTGGGAGGCTGAGACAGGAGGATCCCTTGAGCTCAGGAGTTCGAGACCACCC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,525,500 | 1 | CCGTGAGGAGCCCGGGCCAGGCCTGTCCCCTTGGCTGGTGGAGCCGTCTCTTCTTCACCCGGGCCCTTCCTCCCCGTGCGGCCGTGTCCACGTTACCCTCTGTTATGAGAACAGCAGTTGTTTTGGATCTAAGTCTGCTGTAATGACCTC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,680,200 | 1 | CAAGGTCACACAGGCACAGAGCCCTCCATTAGGAGCACCCCAGCTGCCCCTCCCTGCCCGCGTCTGCCCCGTGGCTTCTCCTATAGGGTCTGAAAGGGACCTCTTCCCAGCGGGACTAGGTGCCCACCCAACCCCAGCCTTACCTTTGCC | 120homo sapiens
|
G000010165 | ASM1016v1 | GCF_000010165.1 | PRJNA224116 | SAMD00060942 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/165/GCF_000010165.1_ASM1016v1 | 643,692,011 | RS_GCF_000010165.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 358,681 | 1,393 | Brevibacillus brevis NBRC 100599 | strain=NBRC 100599 (= 47) | null | Bacteria | Firmicutes | Bacilli | Bacillales | Paenibacillaceae | Brevibacillus | Brevibacillus brevis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 6,296,436 | 1 | 47.27 | 6,296,436 | 1 | 5,917 | 1,875,522 | 87.757979 | 99.73 | 0.27 | 0 | 381 | yes | yes | yes | 20 | high | 3,539,510 | 0 | ATAGCCGTGCAGATGGGCGTGGCAAAGAAACATATATATTCGATAAGGACTTTAACAAGGGGCCTTCTACTTCTAGAAAAGATTATGTTGCATCAGTAAGATTCAATCGATTGAAGTGATGGAGTATACCAAATAACACGACGAGGCACC | 15Brevibacillus brevis NBRC 100599
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,322,300 | 1 | GACAAGTACAGGTGGGATTACAGTGAGGCATAAGAGATGGCTCGGGGGAGTACAGGGGCCAGGCAGAGCACCCTGGGCACAGCCCTGAGGCTTTCCAAATGAAATGATCCCAAAACTCAGACCTGAAGAATAAACAGGAGCTAAGAAGCA | 120homo sapiens
|
G000008765 | ASM876v1 | GCF_000008765.1 | PRJNA57677 | SAMN02603243 | null | 2002/11/22 | Genome Therapeutics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/765/GCF_000008765.1_ASM876v1 | 637,000,076 | RS_GCF_000008765.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,562 | 1,488 | Clostridium acetobutylicum ATCC 824 | strain=ATCC 824 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium acetobutylicum | true | Eubacteria | Firmicutes | 1 | 0.998 | 0.1 | 0.9 | 4,132,880 | 2 | 30.93 | 3,940,880 | 1 | 3,896 | 1,211,240 | 86.343567 | 100 | 0 | 0 | 345 | yes | yes | yes | 19 | high | 91,260 | 0 | AAGATAACAGGGAATATGAGTTCTAAACAAATGGCGTTAAATGACGTGTACTTAAATGATGCTATAATACTTACCCTTGCAAAACTATTAGAATTAACAGGTGAACGTAGTTTAGTAAAAAAGATTAAAGAATTATTCAGTATTCAAAGA | 29Clostridium acetobutylicum ATCC 824
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 430,350 | 1 | GCCGCGCTCCTCCCCCGCTCGCTGTCAGTCACGCCTCGGCTCCGGGCGCGGCCTCCGCGGGCGACAATGGCATGCGGGGCCCCCGCCCGCGCCCCCCTCCGACACCGCTGGGGACAGGGCCGGGTGATCCCGCGCTCCCCGATGCAGCCG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,380,750 | 1 | CAGTTCATCAGATCTGTTGTTTCTCTTGTATGCTTGTTTTAAAATATACAAAATAATATTACTAAATTATGTCTAGTTTCTGGTCTTTTTCCACACTGCAGCAAGCTTTTCTTGAATGCAGACAGACAGGCACTCCTGTTCTTATCTCGA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,302,700 | 1 | AAATACAAAAATTAGTCAGGCATGGTGGCATGCGCCTGCAGTCCCAGCTACTTGGGAGGCTGAGGCCGAAGAATCGCTTGAGCCTGGGAGGCGGAGGTTGTAGTGAGCTGAGATCGGGCCACTGCACTGCAGCCTGGGTGACAGAGCGAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,414,300 | 1 | TATTCAGTTGATTTGAGGTTTGTTTGGAAATGAGTCCCAAATTTGGGAAGCAAATGAGACAGAACCCTCCACACCCTACCACATGCTTCCAGCTCATCCCATGAAAACTCATGAGCACAGTGTGGAGTGTTTTATCTACAGCCACTCCCT | 120homo sapiens
|
G000009305 | ASM930v1 | GCF_000009305.1 | PRJNA224116 | SAMEA3138199 | null | 2006/06/28 | Penn State Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/305/GCF_000009305.1_ASM930v1 | 637,000,130 | RS_GCF_000009305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 382,638 | 212 | Helicobacter acinonychis str. Sheeba | strain=Sheeba | null | Bacteria | Proteobacteria | Epsilonproteobacteria | Campylobacterales | Helicobacteraceae | Helicobacter | Helicobacter acinonychis | true | Eubacteria | Proteobacteria | 1 | 0.994 | 0.9 | 1 | 1,557,588 | 2 | 38.17 | 1,553,927 | 1 | 1,547 | 470,618 | 89.011857 | 99.12 | 0.7 | 100 | 271 | yes | yes | yes | 20 | high | 1,547,780 | 0 | AAAGGGTGGGGTGTTTTCTTATCCGCAAAAGAAATTACGAAAGCTTTTTGAAGTTTTTCCTTTAGCCTTGATCATTGAAAAAGCTAAGGGGGAAGCGTTTTATTTTGATAAGGGGGTTAAAAAGCGTTTGTTGGATCAGGGCGTAGAAAG | 46Helicobacter acinonychis str. Sheeba
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,439,150 | 1 | ATTTTATCAGATGCCTGCGCTATGACAGGACCACAGAAAGAAATGAAGATAAGGAAACAGCTCAGTGGAGGACGGGGCTGTGGTCTTCATTGAGATGTCTTCCTAGGCTGAAGGGAGCAGGGGCCTCTCAACATCAGGACACATGCATGG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,176,600 | 1 | GGAATATTTTGAAGCATTAGAAGAAGTCCTATCTGGTCAGATGCCTGGAGGTGGAGGGGAGAGGGTCAGTGGTCTCTTGAAGGACCCAAACTGTGCCTACTCCCCTGCACGTGGAAAGTGTGGGCTTCAGGGGGCTTCCAGGGAATGTAA | 120homo sapiens
|
G000008565 | ASM856v1 | GCF_000008565.1 | PRJNA57665 | SAMN02603976 | null | 2000/12/11 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/565/GCF_000008565.1_ASM856v1 | 637,000,092 | RS_GCF_000008565.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,230 | 1,299 | Deinococcus radiodurans R1 | strain=R1 | null | Bacteria | Deinococcus-Thermus | Deinococci | Deinococcales | Deinococcaceae | Deinococcus | Deinococcus radiodurans | true | Eubacteria | Terrabacteria | 1 | 0.991 | 0.8 | 1 | 3,284,156 | 4 | 66.61 | 2,648,638 | 1 | 3,248 | 987,980 | 88.625967 | 98.72 | 0 | 0 | 359 | yes | yes | yes | 20 | high | 3,251,170 | 0 | CCTACCGGCCCCACCACGCTCACCGACACCGACGCCAGCAGCACGCCCAGCCCGGTGACCAGCAGCGCGTCGCGCTCCGCGTCGGCGCCCAGGCTGCGGGCCACGTCCTCACCGAGGGCCAGCACGTTCAGCCGGGGCGTGAGCAGCAGC | 35Deinococcus radiodurans R1 ASM856v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,150 | 1 | AGAGAGGCGCGGCGCGCCGGCGCAGGCGCAGAGAGGCGCGGCGCGCCGGCGCAGGCGCAGAGAGGCGCGTCCCCTGGGGGGCGGGGGGAGGTGCGGCGCAGGCGCACAGAGGCGCGTCCCCTGGGGGGCGGGGGGAGGCGCGGCGCAGGC | 120homo sapiens
|
G000007325 | ASM732v1 | GCF_000007325.1 | PRJNA57885 | SAMN02603417 | null | 2002/04/09 | Integrated Genomics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/325/GCF_000007325.1_ASM732v1 | 637,000,117 | RS_GCF_000007325.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 190,304 | 851 | Fusobacterium nucleatum subsp. nucleatum ATCC 25586 | strain=ATCC 25586 | null | Bacteria | Fusobacteria | Fusobacteriia | Fusobacteriales | Fusobacteriaceae | Fusobacterium | Fusobacterium nucleatum | true | Eubacteria | Bacteria | 1 | 1 | 1 | 1 | 2,174,500 | 1 | 27.15 | 2,174,500 | 1 | 2,022 | 670,780 | 90.88917 | 99.95 | 0 | 0 | 297 | yes | yes | yes | 20 | high | 86,710 | 0 | GATATTCCACAATCAAATTTACACTTTCCTTACTAGCATTCATATAAATATTTTCTGCAAACTTGATTTTTTCATACTTTTTCAGATTTGAAGATTCCTGAACAAAATTTCTTAGACACTTATATAAATCAATTTTGACTTCTATATTTT | 41Fusobacterium nucleatum subsp. nucleatum ATCC 25586
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,574,300 | 1 | TGGCTATTGATCTCAGCCTGGTCGGGCCAGGCAGGGAACTTGCGTGTCTGAGGCTGGTCCTGCCTTTCAGAAAGAGCCCTGGGGCTACAGCCTGCCCAGCTGGCCTTCTTTCTAAACACAGACCTCAGGGAAGTGAGGGTTGGCCCCCAT | 120homo sapiens
|
G000007365 | ASM736v1 | GCF_000007365.1 | PRJNA224116 | SAMN02604269 | null | 2002/07/02 | Uppsala Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/365/GCF_000007365.1_ASM736v1 | 637,000,045 | RS_GCF_000007365.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 198,804 | 9 | Buchnera aphidicola str. Sg (Schizaphis graminum) | strain=Sg | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Erwiniaceae | Buchnera | Buchnera aphidicola | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 0.9 | 641,454 | 1 | 25.33 | 641,454 | 1 | 600 | 191,650 | 88.027201 | 98.77 | 0 | 0 | 206 | yes | yes | yes | 20 | high | 567,320 | 0 | TTTTCCTTGAATTAAGTTTTCTTTTTCACTTTTTTCAAATTCAATTTTTGCTGCATTCTTCAAATTTTTTTCTAATTTTTGAAGAATTGTTGAAATTTCTTCATTTGATAATTTTAAATTACCTGAAATAGCGTCTTGTACTCCTAACAA | 17Buchnera aphidicola str. Sg (Schizaphis graminum) Sg
|
G000007605 | ASM760v1 | GCF_000007605.1 | PRJNA224116 | SAMN02603993 | null | 2003/04/14 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/605/GCF_000007605.1_ASM760v1 | 637,000,066 | RS_GCF_000007605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 227,941 | 83,557 | Chlamydophila caviae GPIC | null | GPIC | Bacteria | Chlamydiae | Chlamydiia | Chlamydiales | Chlamydiaceae | Chlamydia | Chlamydia caviae | true | Eubacteria | Chlamydiae | 1 | 0.992 | 1 | 1 | 1,181,356 | 2 | 39.19 | 1,173,390 | 1 | 1,003 | 363,158 | 90.588188 | 99.49 | 0 | 0 | 220 | yes | yes | yes | 20 | high | 740,480 | 0 | AAGGAACTTCCCATCTACCCGGCAAATTTCTAGGTTTTCCTCAGAAGGAAGACTACTTCTTAACCAGCGCATCAGATGGCGTAAATAATAGGGGGAGACACCCGCGTCAGAATAAATGAGTATTTTTGTTCTCATAGTAAATAAACCGGA | 23Chlamydophila caviae GPIC
|
G000010825 | ASM1082v1 | GCF_000010825.1 | PRJNA224116 | SAMD00060943 | null | 2009/08/26 | Acetobacter pasteurianus genome sequencing consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/825/GCF_000010825.1_ASM1082v1 | 644,736,321 | RS_GCF_000010825.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 634,452 | 438 | Acetobacter pasteurianus IFO 3283-01 | strain=IFO 3283 substr. IFO 3283-01 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Acetobacteraceae | Acetobacter | Acetobacter pasteurianus | true | Eubacteria | Proteobacteria | 1 | 0.982 | 0.9 | 1 | 3,340,249 | 7 | 53.1 | 2,907,495 | 1 | 3,156 | 1,006,859 | 88.810714 | 100 | 0 | 0 | 352 | yes | yes | yes | 20 | high | 2,675,660 | 0 | GCATGGGCACTGTACTGGCCTCTGGCGGAATGGCCATGAACTACGCCTATGCGGCAGCGGATGATGCGGCCTCGCTTGATGCGTTGGAACAGCAGATTGCGCGCATTCAAACCGAACAGCGCGAATTGCAAAAAGCACTTGTAAGCGTGC | 0Acetobacter pasteurianus IFO 3283-01 IFO 3283 substr. IFO 3283-01
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,627,200 | 1 | TGGCTTATGGTCTAGCACCCATGTTCAGACATTAGCCAAATAACCAGACAAATCACTGTTTACTTTTAAACTGAAACAATCCTCTGAAAGAAAGGGTCACACTTCCATAAGGGCTTCAAGAGGTATTTTAGCAGTCATCTCCACTACATG | 120homo sapiens
|
G000006725 | ASM672v1 | GCF_000006725.1 | PRJNA224116 | SAMN02603773 | null | 2004/06/04 | Sao Paulo state (Brazil) Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/725/GCF_000006725.1_ASM672v1 | 637,000,348 | RS_GCF_000006725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 160,492 | 2,371 | Xylella fastidiosa 9a5c | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xylella | Xylella fastidiosa | true | Eubacteria | Proteobacteria | 0.98 | 0.993 | 0.9 | 1 | 2,731,750 | 3 | 52.62 | 2,679,306 | 1 | 2,664 | 765,931 | 82.59299 | 99.59 | 0.18 | 0 | 325 | yes | yes | yes | 20 | high | 726,960 | 0 | GTTGGGGGCGCCGGATGTGCGCTATGTGCTGGCACTGCCTGCGGTTTCGGCCGAGCAGGCGTTGCAAGCTGGTGAGGCGTTGCGCCCACGTCTGGAGGGTGCGGTTGCCCAGGGTATTGTTGCTGGTTACGACATGGCGGCGCGTTATTT | 114Xylella fastidiosa 9a5c
|
G000007345 | ASM734v1 | GCF_000007345.1 | PRJNA224116 | SAMN03081414 | null | 2002/04/03 | Broad Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/345/GCF_000007345.1_ASM734v1 | 638,154,508 | RS_GCF_000007345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 188,937 | 2,214 | Methanosarcina acetivorans C2A | strain=C2A | null | Archaea | Euryarchaeota | Methanomicrobia | Methanosarcinales | Methanosarcinaceae | Methanosarcina | Methanosarcina acetivorans | true | Archaea | Euryarchaeota | 0.98 | 1 | 0.8 | 0.9 | 5,751,492 | 1 | 42.68 | 5,751,492 | 1 | 4,884 | 1,470,904 | 75.340086 | 99.84 | 0.03 | 0 | 229 | no | yes | yes | 18 | medium | 3,646,760 | 0 | CCCTATACCGGGTATTTTTTATATTTATGGTTGAAATCAGTATCTAAGGAAAAATAAGAAAAAACGGGACAAAAAAACTGCAAAACAAGAAAAAAGATAAAGAAGGAAAGTCTGACTCTTTTCGAGGTGTATATTTTGAACGGTATGGGT | 61Methanosarcina acetivorans C2A
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,567,400 | 1 | TGGTGGTTCTTTCTGACCTGCACCTGCTGGGGTTGATGCCAACTGTGGACTCTCTCTCTTCTCTCCCTTTCTCCTTTTTCTCTTTTCTCCATTGCTGTCCGAAGTACTCGGTATGGGAGTCCCAAAAGACAGCTCCAGTTTTACAGGTAA | 120homo sapiens
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 1,274,130 | 0 | ACGCCGGGCCCGTTCGGCAGGCGCTTGACGAAGGCCTGGATGAGTTCGGCTCCCTTGAGGCCCGCCGCTTCCGGCAGGCTCTCCGCCCATCCTATTGCCGGCGCCGGCCGTTCGGCCTCGGTCACTTCGACCAGATCGTCTTCGTCGTCG | 86Sinorhizobium meliloti 1021
|
G000007745 | ASM774v1 | GCF_000007745.1 | PRJNA224116 | SAMN02603473 | null | 2004/09/17 | Korea Advanced Institute of Science and Technology, Republic of Korea, Yuseong-gu | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/745/GCF_000007745.1_ASM774v1 | 637,000,156 | RS_GCF_000007745.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 221,988 | 157,673 | Mannheimia succiniciproducens MBEL55E | strain=MBEL55E | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pasteurellales | Pasteurellaceae | Basfia | [Mannheimia] succiniciproducens | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 2,314,078 | 1 | 42.54 | 2,314,078 | 1 | 2,120 | 690,147 | 87.871627 | 100 | 0 | 0 | 329 | yes | yes | yes | 20 | high | 422,110 | 0 | CACCGAGTTCTTCTACCATTACGGTTAAAATGAAACTGAATACGGATCCGGCTTCAGCTTTGGCGGACGTATTATCCAAAGTTCAATCCGTACGTTCGGAATTACCGAGCGGTATCGAAGACCCGACCTTAACTTCTTCAACCGGTGGTT | 57Mannheimia succiniciproducens MBEL55E
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 6,146,270 | 0 | CAAGATCCTGCGCAAGCTGCACCGCATCGCGGACCAGGTCAACTCCATCGAAGAGGACTTCGTCGACCTCTCCGACGCCGAGCTGCGGGCCCTCACCGATGAGTACAAGCAGCGGTACGCCGACGGCGAGAGCCTCGACGACCTGCTGCC | 95Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2
|
G000007985 | ASM798v2 | GCF_000007985.2 | PRJNA57743 | SAMN02603989 | null | 2012/07/31 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/985/GCF_000007985.2_ASM798v2 | 637,000,120 | RS_GCF_000007985.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,231 | 35,554 | Geobacter sulfurreducens PCA | strain=PCA | null | Bacteria | Proteobacteria | Deltaproteobacteria | Desulfuromonadales | Geobacteraceae | Geobacter | Geobacter sulfurreducens | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,814,128 | 1 | 60.94 | 3,814,128 | 1 | 3,417 | 1,176,369 | 90.878544 | 99.35 | 0 | 0 | 363 | yes | yes | yes | 20 | high | 66,950 | 0 | GTTGAAGCAACTGCCCTTGCGTGAAGACCGGCGTCGCGATGCGAGCCCTGCGGCACTAAGCGAAATACCCCTTGCCGACCGGCAAGCTGCTTTCACGCCACCTCCCGTCATTCTTCCGATAAGTGACATTCTTTTCGATGTCTGGGCGCT | 43Geobacter sulfurreducens PCA
|
G000007845 | ASM784v1 | GCF_000007845.1 | PRJNA57909 | SAMN02603432 | null | 2003/04/30 | J. Craig Venter Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/845/GCF_000007845.1_ASM784v1 | 637,000,014 | RS_GCF_000007845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 198,094 | 1,392 | Bacillus anthracis str. Ames | strain=Ames | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,227,293 | 1 | 35.38 | 5,227,293 | 1 | 5,474 | 1,495,110 | 84.244541 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 2,669,420 | 0 | TTCACAAATGAAATTCCGCTTTTTACATCCCCTTTTTTCGTTAGTTCTTTTCCTCTGTCTAAAATTAATGTCATTGGTTGCTTTTTAAATATTAATTTAGAACGATTCCCTCTTCCGCGCCCTGGAAACCAAGCAATCCAATTTAATTCA | 5Bacillus anthracis str. Ames
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,683,450 | 1 | GAAGAGACCCCATGACTGAATAGGAACCACACACATAATCCACACTGGGGTAAGTGCTAGTTCAAAAAGAACACAGTGCTTGTGATCATGAGAGGCAGGGACCTCACCTGTTCAGAATGTGAACCCTGAAAATTTGAGACAGGTCTTGGT | 120homo sapiens
|
G000010085 | ASM1008v1 | GCF_000010085.1 | PRJNA224116 | SAMD00061079 | null | 2006/01/10 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/085/GCF_000010085.1_ASM1008v1 | 637,000,270 | RS_GCF_000010085.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 343,509 | 63,612 | Sodalis glossinidius str. 'morsitans' | strain=morsitans | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Pectobacteriaceae | Sodalis | Sodalis glossinidius | true | Eubacteria | Proteobacteria | 1 | 0.993 | 1 | 1 | 4,292,502 | 4 | 54.5 | 4,171,146 | 1 | 5,742 | 1,142,020 | 78.310831 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 1,694,550 | 0 | GATGACGCCACGTTTTGATCTTCCGCGCTTTTCTCGTTAAAGATTAAGGGTAACCTCGGCGTTCGGGGTTACCGTTTTCTTTCAACCAGCCAAGATGATGAGGGATAAACTTATGAAAAGACAAAAACGAGATCGCCTTGAACGTGCTCA | 87Sodalis glossinidius str. 'morsitans' morsitans
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,275,150 | 1 | ATTTTGCCAAGAAGATGGCCCTGAGAAGGAAAGGTGGATTGATGCCTTGGTTTAGGCTTGCAGCTGGGTGGCATGGGGTCTTTCTAGCAAAGACTTGTCCCCTGGGCTCTCTCTGAGTCCCGTCTGTAACACTCTGTGTTCTCTAGTTCA | 120homo sapiens
|
G000006785 | ASM678v2 | GCF_000006785.2 | PRJNA57845 | SAMN02604089 | null | 2014/04/01 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/785/GCF_000006785.2_ASM678v2 | 637,000,291 | RS_GCF_000006785.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 160,490 | 1,314 | Streptococcus pyogenes M1 GAS | strain=SF370 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus pyogenes | true | Eubacteria | Firmicutes | 1 | 1 | 0.6 | 1 | 1,852,433 | 1 | 38.51 | 1,852,433 | 1 | 1,776 | 539,188 | 85.75128 | 100 | 0 | 0 | 277 | yes | yes | yes | 20 | high | 894,530 | 0 | AAATCCTCAACGCTTCAGGACTGCCGAATGAGGTGCTAAAGGACCATCGTTATCCTGGTTCTGCGTTGGAAGAAGAGAATATGTTGAGTGCTCAGGATGTTGCCATTGTGACGATGCATTTACTGGAAGATTTTCCTGAGATTTTAGAGA | 93Streptococcus pyogenes M1 GAS SF370
|
G000010505 | ASM1050v1 | GCF_000010505.1 | PRJNA224116 | SAMD00060922 | null | 2008/05/20 | Kitasato University | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/505/GCF_000010505.1_ASM1050v1 | 642,555,148 | RS_GCF_000010505.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 431,947 | 837 | Porphyromonas gingivalis ATCC 33277 | strain=ATCC 33277 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Porphyromonadaceae | Porphyromonas | Porphyromonas gingivalis | true | Eubacteria | Bacteroidetes | 1 | 1 | 0.9 | 1 | 2,354,886 | 1 | 48.36 | 2,354,886 | 1 | 1,981 | 685,765 | 85.805173 | 99.92 | 0 | 0 | 278 | yes | yes | yes | 20 | high | 1,162,200 | 0 | GGATATTTCCCCTGTGGTATAGTCGGATTCGGGATGCAACTTGCTCGTTATGTAATGATCCCGAATGGAAGTACGAGGCGTGGCGTACAGATAGACATCGCGATGCAATCCGCTCATATGGAACATATCCTGTCCCTCCAAATAAGAAGC | 75Porphyromonas gingivalis ATCC 33277
|
G000007005 | ASM700v1 | GCF_000007005.1 | PRJNA224116 | SAMN02603227 | null | 2002/11/25 | European/Canadian Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/005/GCF_000007005.1_ASM700v1 | 638,154,518 | RS_GCF_000007005.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 273,057 | 2,287 | Sulfolobus solfataricus P2 | strain=P2 | null | Archaea | Crenarchaeota | Thermoprotei | Sulfolobales | Sulfolobaceae | Sulfolobus | Sulfolobus solfataricus | true | Archaea | Crenarchaeota | 0.96 | 1 | 1 | 0.9 | 2,992,245 | 1 | 35.79 | 2,992,245 | 1 | 3,281 | 874,971 | 86.125133 | 100 | 0 | 0 | 196 | no | yes | yes | 14 | medium | 832,780 | 0 | ATTGATGAAAGGCAAAATTTTAATTGATATGAGCACTATAAGTCCGACATTAAGTATTAGCTTAGCCAAGAGGATAGAAAGCAATGGCGGTACAATGTTTGATGCTCCTGTAATAGGAACTTCAGTATTTGTTGAGCAAAAGAAATTGGT | 97Sulfolobus solfataricus P2
|
G000007825 | ASM782v1 | GCF_000007825.1 | PRJNA57975 | SAMN02603340 | null | 2004/07/06 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/825/GCF_000007825.1_ASM782v1 | 637,000,017 | RS_GCF_000007825.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,900 | 1,396 | Bacillus cereus ATCC 14579 | strain=ATCC 14579 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus cereus | true | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,427,083 | 2 | 35.29 | 5,411,809 | 1 | 5,541 | 1,546,426 | 83.933929 | 98.18 | 0.58 | 18.18 | 383 | yes | yes | yes | 20 | high | 1,355,900 | 0 | TTAGAACAGGGAGAACAATAGACCAATAAGTGCTACTCGGAATAAAATTGCGATAAGTGCAGCAATTCCACCGACAACTGCAGCGATACCGCCAGTTACAGTAGCTCCGCGATTATAAGCGTAAATACCGAGTAAAACAGAAACAAGACC | 7Bacillus cereus ATCC 14579
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,097,450 | 1 | TTCATGCATTTCCACAACATGGTGATAATAAGGTTAAGAGTTGTCTGAACATTAGAGGTTTACTGTATAATTCAGAAATGTATACATAAAACTTTTAATTGGTAGTCAGACACTAATTAAGCATACAGAGGGGGGAACACCGTCTCCCAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 753,600 | 1 | TCTCCTACCCCAAGCCACGCCAGGCTCACAGAGGCCCTCTGGCACCTGTGGGAAGGGAGGGCCGCCCCTCTTCATGCCCAGGGACCTAAGGCCACAGAGGCACTTGTGGCACACGGCCCCGAGGCGTGGGGCCCGGGCTGGTTTTCTGAA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,011,450 | 1 | TATAGGTTCATTTTTTCTGTTCTAGAACTTCGTAGAACTGGAATCCTGCAGTATATGCACTCAGGTATATACTTGGCTTCTTTCACTCCACATCGTATTTTGCCATTCATCATGTTGCTACTGCCTACTGTGTTATTTATGCCTTGTCTA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,598,400 | 1 | GGTTTTTGTCCCCAGCTGCTGAGACATGCTGTGTAGGCCCTTGGCATTTCCCTTCTGATAAGGATGTGTCTATTTACCTGGGGCCTTGGCCACTGCGCAGCTTAGCAATGTGCTTTGTGATGAGGGCTTTGGGGCATGCAGTATATACTC | 120homo sapiens
|
G000010085 | ASM1008v1 | GCF_000010085.1 | PRJNA224116 | SAMD00061079 | null | 2006/01/10 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/085/GCF_000010085.1_ASM1008v1 | 637,000,270 | RS_GCF_000010085.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 343,509 | 63,612 | Sodalis glossinidius str. 'morsitans' | strain=morsitans | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Pectobacteriaceae | Sodalis | Sodalis glossinidius | true | Eubacteria | Proteobacteria | 1 | 0.993 | 1 | 1 | 4,292,502 | 4 | 54.5 | 4,171,146 | 1 | 5,742 | 1,142,020 | 78.310831 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 4,260,100 | 0 | CGCAGATACAGCGGCGCGGAACGGTGTTGTTTGGTGAGGAAGACAGACCGCTCAGGTCAACCGCCGTCAGCCCTGTTTGTCGTGTGATGCCCAAACCGGATAGAAATGCGTCTTTCGTGGCGGCTTACTTCTTGCAGCGATATGAGGAAA | 87Sodalis glossinidius str. 'morsitans' morsitans
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 5,268,770 | 0 | AGTTCTCCCCGACGAAAATGCCACTGGAAATGCCACTCAAAATCACCAGCACTCACTTCACCTTCTAGGAAGCCGTGTTGCCAGGATTGGCGAATGATTTTGACATGGGCAGTAGTTTCTGGCAAAGGTTTAGCACTCACAATGCTTGGT | 70Nostoc sp. PCC 7120 ASM970v1
|
G000007525 | ASM752v1 | GCF_000007525.1 | PRJNA57939 | SAMN02603675 | null | 2005/01/21 | Nestle Research Center, Switzerland | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/525/GCF_000007525.1_ASM752v1 | 637,000,031 | RS_GCF_000007525.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 206,672 | 216,816 | Bifidobacterium longum NCC2705 | strain=NCC2705 | null | Bacteria | Actinobacteria | Actinobacteria | Bifidobacteriales | Bifidobacteriaceae | Bifidobacterium | Bifidobacterium longum | true | Eubacteria | Actinobacteria | 1 | 0.996 | 0.9 | 1 | 2,260,266 | 2 | 60.13 | 2,256,640 | 1 | 1,833 | 667,063 | 86.967994 | 100 | 0 | 0 | 289 | yes | yes | yes | 20 | high | 1,131,650 | 0 | TTGCTTCGTGCCATAGGTATTCATATGCCTTCAATTCAAACGGATAATATGTTCTATTAATTGTAGTGAGGGAGAGAAGAAATCCAAGAAAAACTCGGGACGACAACTGACCATCTGCACAAGGCATGACCTATTGCAGTTCAAGACCCG | 13Bifidobacterium longum NCC2705
|
G000010125 | ASM1012v1 | GCF_000010125.1 | PRJNA224116 | SAMD00061076 | null | 2005/08/12 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/125/GCF_000010125.1_ASM1012v1 | 637,000,284 | RS_GCF_000010125.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,451 | 29,385 | Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | strain=ATCC 15305 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus saprophyticus | true | Eubacteria | Firmicutes | 1 | 0.992 | 1 | 1 | 2,577,899 | 3 | 33.19 | 2,516,575 | 1 | 2,502 | 730,892 | 83.519176 | 99.44 | 0 | 0 | 348 | yes | yes | yes | 20 | high | 140,660 | 0 | TTATTTTCAATATTATTAACACATAAATATGATCAAAACATTGAAACATCTTTAAATGTGATTAAAAATCCATTTGCATAAAATGAAATCTATTTTCATTTATGGATATTCAATAGTGATAAAAAATGAAAATAGCAATCAATTTCGCCC | 90Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 ASM1012v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,207,500 | 1 | TTCTTGCTGTGTAATCCCGTGGTGGAAGCAGGAGGGCAAGAGAGCACATGGAGGGGAGGAAGGGGCCAAACGCGTCCTTTTATCAGGAACCCACTTGGGGGAGATAATGGCATTCAGCCATTCAAGGGGGCAGAGCCTTCAGGGCCCCCT | 120homo sapiens
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 6,120,270 | 0 | CCTCGACGAGGTCATCGACAAGGCCGACATCTTCGTCACCACGACGGGCAACAAGGACATCATCATGGCCTCGGACATGGCCAAGATGAAGCACCAGGCGATCGTGGGCAACATCGGCCACTTCGACAACGAGATCGACATGGCCGGCCT | 95Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,780,450 | 1 | AGAAAGCCTGTACCAACCCATGGAACCCACTTTGCTCACTAGGCTGGGACCCCAGGGGACCCAGCAGGAGCAACAGGGCAGCGGTAGCCCGTGACTTTGATGTTTGCCTGTCTTCACTCGCTGTCTTTGTTCTTAATGGAAGCTGCTTCT | 120homo sapiens
|
G000007825 | ASM782v1 | GCF_000007825.1 | PRJNA57975 | SAMN02603340 | null | 2004/07/06 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/825/GCF_000007825.1_ASM782v1 | 637,000,017 | RS_GCF_000007825.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,900 | 1,396 | Bacillus cereus ATCC 14579 | strain=ATCC 14579 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus cereus | true | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,427,083 | 2 | 35.29 | 5,411,809 | 1 | 5,541 | 1,546,426 | 83.933929 | 98.18 | 0.58 | 18.18 | 383 | yes | yes | yes | 20 | high | 1,664,520 | 0 | ATGGAGCGGCCTATGCATCTGTTATATCTACAGTTATTACGTTTATTGTCATGCTTGTGTATTTAAAGAAGAAAAATCACCCATTACAACTAGATGGAACGGTTAGAAAATACCTTCGAATGGATGGGGAGTTATTAAAGCTATTACTAA | 7Bacillus cereus ATCC 14579
|
G000007205 | ASM720v1 | GCF_000007205.1 | PRJNA224116 | SAMN02602979 | null | 2003/07/25 | ALTANA Pharma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/205/GCF_000007205.1_ASM720v1 | 637,000,071 | RS_GCF_000007205.1 | Monoisolate | Complete Genome | Full | na | Major | 182,082 | 83,558 | Chlamydophila pneumoniae TW-183 | strain=TW-183 | null | Bacteria | Chlamydiae | Chlamydiia | Chlamydiales | Chlamydiaceae | Chlamydia | Chlamydia pneumoniae | true | Eubacteria | Chlamydiae | 1 | 1 | 1 | 1 | 1,225,935 | 1 | 40.58 | 1,225,935 | 1 | 1,055 | 372,698 | 89.583869 | 99.49 | 0 | 0 | 219 | yes | yes | yes | 20 | high | 246,480 | 0 | TCGTTCCAGGAGTGAAAACCCTCTTTCCACAAACCTACCACCTTCCCTATCTAAAGTTTGTCCAAGGAGAAAATGTCGTTCACACTCCTCTAAAAGTAGGCGTAATGTTCTCAGGAGGACCTGCTCCAGGAGGACATAATGTCATCCAAG | 25Chlamydophila pneumoniae TW-183
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,558,700 | 1 | TTGGGAACACCTAATAGAGGATCAGGCGATATTGAACTAAGTATCTTAGGTACAATGCTGGTGCTGTGGTTAAGACAAAATTCTCAGATGAGTGCTGAGGTATTGAGGGGTGGAGCTCAGGGGATTGCTACGCACTTTCAAACAGTTCAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,349,950 | 1 | AAAAAGCAGATTTTAATTTAAAAACAGATTTTTATGCAGTATAGCCATGTAAAGTTCTTTTCCAGTGTAAAATCAAAGTTTCTCTGTATCCCACTTCACCTGTAGAAACACTGAAATTTAAAAATATGAGTTTTAACATTTTGCCTATTT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,422,300 | 1 | GGCCAGGGGTCTCTCTAACACCTTCAAGCCACACAAGCAGGGTCTTGTCGTCCATTTTTGGAAAACTGCCCAGGGGCAGCTGTGTGGCCCCCACCCGAAGGTGACATGCTCCCCAGGGCCGAGGACGGTGCAGGAGCGGGAGGGAACCTG | 120homo sapiens
|
G000007785 | ASM778v1 | GCF_000007785.1 | PRJNA57669 | SAMN02603978 | null | 2003/03/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/785/GCF_000007785.1_ASM778v1 | 637,000,101 | RS_GCF_000007785.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,185 | 1,351 | Enterococcus faecalis V583 | strain=V583 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Enterococcaceae | Enterococcus | Enterococcus faecalis | true | Eubacteria | Firmicutes | 0.99 | 0.991 | 1 | 1 | 3,359,974 | 4 | 37.38 | 3,218,031 | 1 | 3,271 | 1,000,353 | 87.714339 | 99.53 | 0.31 | 0 | 309 | yes | yes | yes | 20 | high | 2,141,620 | 0 | ACTAAAAGCTCTTGACTTACTTGCCTGATCCTTTGTAACAACAAACAAACTCCAACCACTAAAGTTATAATATTGATATTGACCATTTAAACTACTTGTCATAGGAATATCTGCCAACGTATAACTCCCTGTCGCACTTTTATCCCCTTG | 37Enterococcus faecalis V583 ASM778v1
|
G000007325 | ASM732v1 | GCF_000007325.1 | PRJNA57885 | SAMN02603417 | null | 2002/04/09 | Integrated Genomics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/325/GCF_000007325.1_ASM732v1 | 637,000,117 | RS_GCF_000007325.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 190,304 | 851 | Fusobacterium nucleatum subsp. nucleatum ATCC 25586 | strain=ATCC 25586 | null | Bacteria | Fusobacteria | Fusobacteriia | Fusobacteriales | Fusobacteriaceae | Fusobacterium | Fusobacterium nucleatum | true | Eubacteria | Bacteria | 1 | 1 | 1 | 1 | 2,174,500 | 1 | 27.15 | 2,174,500 | 1 | 2,022 | 670,780 | 90.88917 | 99.95 | 0 | 0 | 297 | yes | yes | yes | 20 | high | 1,780,220 | 0 | TGAAATTAGGAATAAAGTTAAAAATAAAGAAGACATTTCAGGACTTGTAAATAAAAAAGTTAAAAAATTAATTGAAAAAGAATATATAGATTAAAAATGAGAGTCATTGTAAAATTTTGCAATAACTCTCATTATATTTTATAAATTTGT | 41Fusobacterium nucleatum subsp. nucleatum ATCC 25586
|
G000007265 | ASM726v1 | GCF_000007265.1 | PRJNA57943 | SAMN02604013 | null | 2002/08/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/265/GCF_000007265.1_ASM726v1 | 637,000,285 | RS_GCF_000007265.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 208,435 | 1,311 | Streptococcus agalactiae 2603V/R | strain=2603V/R | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus agalactiae | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,160,267 | 1 | 35.65 | 2,160,267 | 1 | 2,106 | 643,747 | 87.791509 | 100 | 0.18 | 0 | 298 | yes | yes | yes | 20 | high | 924,950 | 0 | AATGTATCTATAATTTTTTCAAATTGTTTTCGTTTAATCTGAATACGATTGCCATTCATAATCAGCCAATTTGCATTTTTATTTTCCTCTGCCAAGCGTCGTAGCTTGTTTTCGCCAATACGAAAATATTTTGACGCTTCTTCAATGGTT | 91Streptococcus agalactiae 2603V/R
|
G000007985 | ASM798v2 | GCF_000007985.2 | PRJNA57743 | SAMN02603989 | null | 2012/07/31 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/985/GCF_000007985.2_ASM798v2 | 637,000,120 | RS_GCF_000007985.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,231 | 35,554 | Geobacter sulfurreducens PCA | strain=PCA | null | Bacteria | Proteobacteria | Deltaproteobacteria | Desulfuromonadales | Geobacteraceae | Geobacter | Geobacter sulfurreducens | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,814,128 | 1 | 60.94 | 3,814,128 | 1 | 3,417 | 1,176,369 | 90.878544 | 99.35 | 0 | 0 | 363 | yes | yes | yes | 20 | high | 1,838,070 | 0 | CAAAAACCCCGCTCCAGCGGCGTCTCGCCGATTTCGGCAAGCGCCTTGCGCTGGCGGTGCTCGCCATTTGCGCGGTGGTATTCACACTGGGGCTGCTGCGGGGAGAGCCTCTCCTCCTCATGCTGCTAACCTCCATATCCCTGGCAGTTG | 43Geobacter sulfurreducens PCA
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 4,268,290 | 0 | TTGGCTGTAGGTTTACCCCAAGTAATATCGTTACCTTTTTGACCCAATACGGCGTAGATATCATACTTGGCACGATCAAATTGTTCTGCCCAAATACGATAGGCTTCGACTTTTTGATATTCCTTTGACCCTTGCCAAGCTAACCAGAAA | 70Nostoc sp. PCC 7120 ASM970v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,274,050 | 1 | CGGTGTCCTGATCCCGCATGGTCCGCCGATGTGCGGCCCGGATCCGAAATACCCCCAGGATAATCATGAACACCAGGAAGCTGACGCACACCACGATCACAACTGTCGCAGTGCTGGGGACGACTGTGGGAGAATGAGGGGGCGGGATGC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,919,150 | 1 | TCCGTCTAGGGGTGCAGGTGGGCTGGGCTCCCGACATCCCCAAGGCCCACAGAGGAGTCTGGTGAGCGTTGGGGCAGCCACGGCGAGGTCCACACCATGGCCTTGTGACTGGCCAGGTATATGGTCAGGCGGGGTGGGCGGCTCTGTGGA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,903,800 | 1 | AGGGTTTATAAAATGCTCCCCAAGGAACACAAACTGAGGTGGTAGGAGGGGACAGGTGGTGGGGGTTCTGACTCAAGTGCCATAATAAGCTCTCCAAGGTTGAGTAGATTTTCTTGAATGAATGCTTCTTCATTTGCTGTGTGCCCTTAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 237,000 | 1 | ATCAGCATCAGGGGTTCATGCTAACACAGAGAAAATGCGTATGACTGCAGGAGTCCATGCTTGGTTTAAATAGCCCTGCTGTTGACTCAGATATGTACAGGTAGGCAGGAACCACACACTGTACACATATACCACATGCCACCACACACC | 120homo sapiens
|
G000008185 | ASM818v1 | GCF_000008185.1 | PRJNA57583 | SAMN02603967 | null | 2004/02/03 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/185/GCF_000008185.1_ASM818v1 | 637,000,327 | RS_GCF_000008185.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,275 | 158 | Treponema denticola ATCC 35405 | strain=ATCC 35405 | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Spirochaetaceae | Treponema | Treponema denticola | true | Eubacteria | Spirochaetes | 1 | 1 | 1 | 1 | 2,843,201 | 1 | 37.87 | 2,843,201 | 1 | 2,578 | 885,778 | 91.799314 | 100 | 0 | 0 | 281 | yes | yes | yes | 20 | high | 2,488,590 | 0 | TTGCTAACAAAATCTTGTTTACGGAGGAATATGATAAAAATGAGTAAAAAGATAAAAGCTATAGGATTCTTTGTAACAGCTATTTTAGTATTTGCTTTTGCTTGCGAACCGGAGATGCTTTACGGGACTGCAAAGGTAGCTGGCTCGACC | 104Treponema denticola ATCC 35405
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,080,100 | 1 | TGCTGGGTCCTCCTGGGTGTGCTAGGTCCTCCTGGGTGTGCTGGGTCCTCCTGGGTGTCCTGGGTCCTGCCAGGTGTGCTGGGTCCCCGTGGGTGTGCTGAGTCCTTTCCAGGTGTGCTGGGTCCTCCTGGGTGTGCTAGGTCCTCCTGG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 167,250 | 1 | TCATAACAAACTTGAGAGGCTGAGGTGAGACAATCGATTTAGCCCAGGAGTTTGAGATCAGCCTGGACGACGTAACTAAATCTCATCTCTACAAGGAAGAGGTGGGAGGATCACTTGAGCCCAGGAATTTGTGGCCAGCCTGGGCAACAA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,157,800 | 1 | AAATCCTCTGCTAGTTTTATAAACACTTTTGGACAATTTCCTCAAATTTATAAAGGGTAAGAATTGAGGCTTCACAGATGACAACGAAAATGGCAAGGAATGCATCAATCTTCTTATGCAGTGCCGAACTCAGAGCCAAAACAACAGAAG | 120homo sapiens
|
G000009925 | ASM992v1 | GCF_000009925.1 | PRJNA58195 | SAMD00061068 | null | 2004/09/16 | Kitasato Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/925/GCF_000009925.1_ASM992v1 | 637,000,025 | RS_GCF_000009925.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 295,405 | 817 | Bacteroides fragilis YCH46 | strain=YCH46 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Bacteroidaceae | Bacteroides | Bacteroides fragilis | true | Eubacteria | Bacteroidetes | 1 | 0.998 | 0.9 | 1 | 5,310,990 | 2 | 43.2 | 5,277,274 | 1 | 4,416 | 1,603,639 | 88.979964 | 99.26 | 0 | 0 | 347 | yes | yes | yes | 20 | high | 231,400 | 0 | GCCGGTGCTGGGGTTGACCTTCCTGATCATGGCAATGGGCATAGCTATTCCTTTCACATCGTTTGGCCTGTCGATAGGACTTGAACCGTTACCGTTGAGTTACTTCCCCTGGCTGGTGCTTATCTTGGTATCCTACTGTGTTCTTACACA | 10Bacteroides fragilis YCH46
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,948,000 | 1 | TGTTGAATTTCACATTTGCTGATCCACCTGTCCACTCCACATCGCCACTTGGCTGTCCAACAAGTGTCTCAAATATCAGGAGCCCAAAGCTGAGCCCCTGAACTTCCCCTCCTGAGTCCCACTTCACTGCAGCCTGCCCATCTTGGTCAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,054,250 | 1 | CCCACAGGGCAGGCTCATTTAGAGGGACAGGGCCTTTTCAGAGAGGGTGGCTTCCCACTAATGACCCTTGTCCCTAGCCCCTCCACCCTCACTGCTGCTGAAGGTGCCAAGCCACCCTCCCTCCATCTCTCTACTGCCTGCTGGGAGGGG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,556,950 | 1 | GCCCAGGAAGTTGAGGCTAAGGTGAGCCATGACTGCACCACTGCATTCCAGCCTGGGCGAAGGAGTAAGACCCTGTCTCCAAATAAAAAAGGAGTAAGGCCTTGTCTCCAAATAAAAAAAAAGATCTTTTGTGTGTTAACGACATGACTG | 120homo sapiens
|
G000010585 | ASM1058v1 | GCF_000010585.1 | PRJNA224116 | SAMD00060930 | null | 2009/01/28 | Juntendo University School of Medicine | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/585/GCF_000010585.1_ASM1058v1 | 643,348,562 | RS_GCF_000010585.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 458,233 | 69,966 | Macrococcus caseolyticus JCSC5402 | strain=JCSC5402 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Macrococcus | Macrococcus caseolyticus | true | Eubacteria | Firmicutes | 1 | 0.965 | 1 | 1 | 2,219,737 | 9 | 36.56 | 2,102,324 | 1 | 2,352 | 677,409 | 89.896055 | 96.13 | 1.1 | 0 | 339 | yes | yes | yes | 20 | high | 1,318,980 | 0 | TTAAAAGCCTCAAGCTGCTGCTGCATGTACTTTCTAATCGCTGGTTTAACAAGTGTATAGACAACTATCGATTCCTGTTCCTTTGATAGATTAATAACTTCATCAATATTCTCGGTCGTCTCGATATAAGGTAATCGTATTGTATCAATC | 55Macrococcus caseolyticus JCSC5402
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,897,300 | 1 | ACACTGGGCACTTATGGTTTCACTGGGTGCAGGCACTGGGCATGGATGGTTTCATTGGGTGCATGCCCTGAGCACTCATGGTTTCACTGGGCACAGGCCCTGGGCACTCATGGTTTCACTGGGTGCAGGCCCTGGGCACTCATGGTTTCA | 120homo sapiens
|
G000008165 | ASM816v1 | GCF_000008165.1 | PRJNA58091 | SAMN02598266 | null | 2004/06/24 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/165/GCF_000008165.1_ASM816v1 | 637,000,015 | RS_GCF_000008165.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 260,799 | 1,392 | Bacillus anthracis str. Sterne | strain=Sterne | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,228,663 | 1 | 35.38 | 5,228,663 | 1 | 5,471 | 1,495,624 | 84.251844 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 4,288,830 | 0 | GTCCGCGGTGGCTAATGGCATTTTTCTCATCTGAACTTAGTTCCGCCATCGCTTTTTTATATTCTTCCACATAAAAGATTGGATCATATCCAAAGCCGTTTTCCCCGCGGCGTTGTTCTAAAATAAATCCTTCACATGTCCCGTTTACAA | 6Bacillus anthracis str. Sterne ASM816v1
|
G000008605 | ASM860v1 | GCF_000008605.1 | PRJNA224116 | SAMN02604348 | null | 1999/12/22 | US DOE Joint Genome Institute (JGI-PGF) | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/605/GCF_000008605.1_ASM860v1 | 637,000,328 | GB_GCA_000008605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 243,276 | 160 | Treponema pallidum subsp. pallidum str. Nichols | strain=Nichols | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Spirochaetaceae | Treponema | Treponema pallidum | true | Eubacteria | Spirochaetes | 0.99 | 1 | 1 | 1 | 1,138,011 | 1 | 52.78 | 1,138,011 | 1 | 1,009 | 357,124 | 92.473447 | 100 | 0 | 0 | 190 | yes | yes | yes | 20 | high | 262,210 | 0 | AAGGCTTTATGGTTACTAGGGACGCGGCTCATGCCGGAGGGGACTATGTTGGTTATTTCAAGGACGTCAAGATTATCTATGATAAGGCGGTGCTGAGTACGGTGCGCGATTTTGCGGACGAGGACCTGTGGGGTATCCAGGCGCGGCGTG | 105Treponema pallidum subsp. pallidum str. Nichols ASM860v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,122,850 | 1 | GTGGCTTAGGAAACCCCTGGAAAGGTCAGCAGTGGGTGGGGGTGGCGGGGCAGACCCTCATGCTTCCCTATGGGAAGGTTAACCCAGCAGGCAGACCTCCCTGGCGCACATCTTCACATCTTGCTCTAGGACAGATGGGGGAGGGGAGGA | 120homo sapiens
|
G000010665 | ASM1066v1 | GCF_000010665.1 | PRJNA224116 | SAMD00060954 | null | 2009/06/11 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/665/GCF_000010665.1_ASM1066v1 | 644,736,352 | RS_GCF_000010665.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 573,370 | 184,917 | Desulfovibrio magneticus RS-1 | strain=RS-1 | null | Bacteria | Proteobacteria | Deltaproteobacteria | Desulfovibrionales | Desulfovibrionaceae | Desulfovibrio | Desulfovibrio magneticus | true | Eubacteria | Proteobacteria | 0.99 | 0.996 | 1 | 1 | 5,315,620 | 3 | 62.67 | 5,248,049 | 1 | 4,555 | 1,546,858 | 85.744052 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 1,148,420 | 0 | CATCCCTCTTTGACCTTGGGGATGTCGGCATGACGCGGGAGCAGGTGCAGAAAGAACTTCTGGAGTTGCTGGCCGGGGCCAGCGAAGAGCAAGTGCGAGCGATCCTGACCATGGCCCGGGTGCTGATCCAGAAGTGACCTGGGCTTTCCC | 36Desulfovibrio magneticus RS-1
|
G000007625 | ASM762v1 | GCF_000007625.1 | PRJNA224116 | SAMN02603289 | null | 2003/02/05 | Gottingen Genomics Laboratory | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/625/GCF_000007625.1_ASM762v1 | 637,000,080 | RS_GCF_000007625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 212,717 | 1,513 | Clostridium tetani E88 | strain=Massachusetts substr. E88 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium tetani | true | Eubacteria | Firmicutes | 1 | 0.997 | 1 | 1 | 2,873,333 | 2 | 28.64 | 2,799,251 | 1 | 2,799 | 856,294 | 87.797934 | 98.28 | 0.14 | 0 | 315 | yes | yes | yes | 20 | high | 1,740,310 | 0 | AGTTTCACCTATCTCACATATAAATTTAAATTTTCCAAGTCCTCTTATAGTTATAATACTATTAGGTTTTACAACTTTTGCTTTATCCTTTACAGTTAGGTAATCTAAAAGTACTTTTCCACTTTGTATTAATTCTTCCCCTTTACTTCT | 30Clostridium tetani E88 Massachusetts substr. E88
|
G000010645 | ASM1064v1 | GCF_000010645.1 | PRJNA224116 | SAMD00060940 | null | 2008/11/12 | RIKEN Genomic Sciences Center (GSC) | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/645/GCF_000010645.1_ASM1064v1 | 643,348,524 | RS_GCF_000010645.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 511,995 | 511,435 | Candidatus Azobacteroides pseudotrichonymphae genomovar. CFP2 | null | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | null | Candidatus Azobacteroides | Candidatus Azobacteroides pseudotrichonymphae | true | Eubacteria | Bacteroidetes | 1 | 0.968 | 1 | 1 | 1,224,919 | 5 | 32.95 | 1,114,206 | 1 | 1,089 | 310,957 | 74.780128 | 89.51 | 1.09 | 0 | 252 | yes | yes | yes | 20 | medium | 496,860 | 0 | GAGTTTGTCAATTTGAATACTTTTTTGAAAGTTATTTTTATTTATATATCGGAATTACTTATTTCTTATCAACATTTATTGCAAAATCTAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAAAACAGTACTTCAGTATTTATATTGAACCT | 19Candidatus Azobacteroides pseudotrichonymphae genomovar. CFP2
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,069,950 | 1 | TTCTGGATCTTGAATGTTTCTACCTGAAGATTGTGCAGAGCTGTGATTCTCAAAATGTGGCATGAGGACTCCTGGGAGGTCCCTAGACCCAGTGGTGGGTGGGGGTCTTCAAGGCCAAAACTGTTGTCTTCCAGATACTAAGATGATTAA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 471,150 | 1 | GGGCCTGGGGGGCGGAGCGGGGCGGGAGCGGGGGAGGGGCCTGCGGGGCCCGGCGGGGAGGAGCGGGGCTGGGAGGGGCCTGGGGGGCGGAGCGGGGCGGGAGCGGGGGAGGGGGCGGCCCGTCTGACCGGCAAAGCCCCGCCCGCAGGC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 522,000 | 1 | CATACAATAAACCACATCCGTGTAAAGTACACAAGCGGGTGAGTGTGACCACCCCCTTGAAGCTGCCACCACAGCCAGGACGGTGCCCGGTCCCACACAGCTGCCAGCACTCGCTGCGGCCCCCACAAGCCCGGGCTCCCGGCAGCCAGG | 120homo sapiens
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 811,980 | 0 | AGGATGCCACGCCACGTGCTTACCAGCAGCAAGCCGCCCGCCTCGATCACTACACGGCCAGCAGCTCCCACTGGGATTTCTGCCACTGTCTGGCCGTTCGCCGGATCCCAGAGCCGTACGGTGCGGTCGTCACTGGCAACGGCTAGGAGT | 96Streptomyces griseus subsp. griseus NBRC 13350
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,453,750 | 1 | GCAGAATCCTTGGTGAGGCCAGTTTACCCAGAACCCCGGAAAATTCTGAAATGGACGAGGTTGCAGAACATTTAGAGGCGTGGTCTTCCTGCGTCGTTGAGCTGGGAACGTTGCTACCTCTGAGCTTGGGGCCTAACCTGGGATTAACCT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,133,950 | 1 | CTCCATCTAGACCAGCCAGCATTGGTTTCTTCCACTCCCCCAGCTGCCGCGTGGGAGGCGCCACTGCAAACTTCCCTGGGGTCTCCCAGCTGCTCAGAGATCCCCATGCCCTTCCCTGATCAGCTCCCTGCCCGGTTCTCATCCCGGCGA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,664,900 | 1 | GAGGTCAAGGGTCCAGGGTCAAAGCGGCACCTCCGCAGGAGTGGTGTCAGGGCCCCCGGCTCTAGAGGGCTTTGGGAGAGGGGATGTGCGCAGAAGCCCCCGGCTCTAGAGGGCTTTGGGAGAGGGGATGTCCGCAGAAGCCCCTGGCAT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,282,200 | 1 | TGGGAGAGACTCGCCATGCTCATGTGTTTCCTCCACTGTTTGCCGGATGCTGTTATTCTGTGGATCCTGGAGGAGAATCCCTCGTGAAAAACAAAAATTACCCCCAGAGAGGGGGAAACAGGAAGACAAAGCTTGTTTTCTGGCTGTGCC | 120homo sapiens
|
G000009365 | ASM936v1 | GCF_000009365.1 | PRJNA224116 | SAMEA3138202 | null | 2006/07/24 | German Research Centre for Biotechnology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/365/GCF_000009365.1_ASM936v1 | 637,000,004 | RS_GCF_000009365.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 393,595 | 59,754 | Alcanivorax borkumensis SK2 | strain=SK2 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Oceanospirillales | Alcanivoracaceae | Alcanivorax | Alcanivorax borkumensis | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,120,143 | 1 | 54.73 | 3,120,143 | 1 | 2,820 | 929,045 | 87.73194 | 100 | 0 | 0 | 352 | yes | yes | yes | 20 | high | 2,654,600 | 0 | CATCCAGACGAGACACGGTAATGACGGGAAGCGCCATGATTTTCTCCTTAACGTAAAACGCCCCACACGAGCACGGGTCCGTAATGCCGAAATCATTCAGGCACAGATTGGACACTCATGCGGAAGGGGCGAAAAGATCAACAGAAATGG | 1Alcanivorax borkumensis SK2
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,709,100 | 1 | GGTGCCACATCCCCCAAAATATCAGGGAATGAGAGAATACAGTTGAAGTACTTCTTGGCATGTATGCACACCAGAAAGCAAACAGACAAGTGAAGTTTGTCTTGCTTACATTTTCTTGATGAAAACTGGAACTGCAGCTATGGTTGATCT | 120homo sapiens
|
G000010125 | ASM1012v1 | GCF_000010125.1 | PRJNA224116 | SAMD00061076 | null | 2005/08/12 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/125/GCF_000010125.1_ASM1012v1 | 637,000,284 | RS_GCF_000010125.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,451 | 29,385 | Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | strain=ATCC 15305 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus saprophyticus | true | Eubacteria | Firmicutes | 1 | 0.992 | 1 | 1 | 2,577,899 | 3 | 33.19 | 2,516,575 | 1 | 2,502 | 730,892 | 83.519176 | 99.44 | 0 | 0 | 348 | yes | yes | yes | 20 | high | 2,049,320 | 0 | TTTTAGCATGGATTTGTTCCATCATTGCCATAAATGAATAAACGGCTTTTTTTCTTAAATCCGTAGTATGTAACATAATCAATGGCATGCCATCGTCAGCTTGATGTGTATCTAATCCTGTTAAACCAGCTAATGCTTTTTTAAAAGCCT | 90Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 ASM1012v1
|
G000010785 | ASM1078v1 | GCF_000010785.1 | PRJNA224116 | SAMD00060961 | null | 2010/02/11 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/785/GCF_000010785.1_ASM1078v1 | 646,311,936 | RS_GCF_000010785.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 608,538 | 940 | Hydrogenobacter thermophilus TK-6 | strain=TK-6 | null | Bacteria | Aquificae | Aquificae | Aquificales | Aquificaceae | Hydrogenobacter | Hydrogenobacter thermophilus | true | Eubacteria | Bacteria | 1 | 1 | 0.8 | 1 | 1,743,135 | 1 | 44 | 1,743,135 | 1 | 1,905 | 573,308 | 96.888881 | 98.78 | 0.51 | 0 | 310 | yes | yes | yes | 20 | high | 1,103,050 | 0 | AAGGAAAAAGCTTACTCTATGCTACCGTTGTAAGAACTGTAACAGAGGAGCTTAGAAAACTTATGGATGAAAGTGATTGCGTTATATTTGATGGGACCTTCTGGGAAGAAGAGGAGTTACTTAAGTATGATCCTAAAGGAAAAAGATCAA | 49Hydrogenobacter thermophilus TK-6 ASM1078v1
|
G000007005 | ASM700v1 | GCF_000007005.1 | PRJNA224116 | SAMN02603227 | null | 2002/11/25 | European/Canadian Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/005/GCF_000007005.1_ASM700v1 | 638,154,518 | RS_GCF_000007005.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 273,057 | 2,287 | Sulfolobus solfataricus P2 | strain=P2 | null | Archaea | Crenarchaeota | Thermoprotei | Sulfolobales | Sulfolobaceae | Sulfolobus | Sulfolobus solfataricus | true | Archaea | Crenarchaeota | 0.96 | 1 | 1 | 0.9 | 2,992,245 | 1 | 35.79 | 2,992,245 | 1 | 3,281 | 874,971 | 86.125133 | 100 | 0 | 0 | 196 | no | yes | yes | 14 | medium | 1,560,000 | 0 | AAGTATTACAAGAGAAAAACAAATAAGCAAGAAAGAAGAAAACAACATAAGCCCAGTCGCAACATGGGGATAAAAACCCCATTAGATGAGGCTGGCTGTGAAGCCCCTAGAACGATCTAACAAGAGGGGACAAAACCCCGAGTAGGAGTG | 97Sulfolobus solfataricus P2
|
G000007785 | ASM778v1 | GCF_000007785.1 | PRJNA57669 | SAMN02603978 | null | 2003/03/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/785/GCF_000007785.1_ASM778v1 | 637,000,101 | RS_GCF_000007785.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,185 | 1,351 | Enterococcus faecalis V583 | strain=V583 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Enterococcaceae | Enterococcus | Enterococcus faecalis | true | Eubacteria | Firmicutes | 0.99 | 0.991 | 1 | 1 | 3,359,974 | 4 | 37.38 | 3,218,031 | 1 | 3,271 | 1,000,353 | 87.714339 | 99.53 | 0.31 | 0 | 309 | yes | yes | yes | 20 | high | 1,715,740 | 0 | TAAAGACAGTTGTCTTTCTCTAGCTCACAGGACTAATTTCGGCTCTATAATTTATGGAACTGATAAACCAGAATGACTGCTTCAGCTCAATTCCAATTAACTAAAGTCATAAAAAAAGACAAGTTGCTTTTTCGAAGATTCTCGAAAAAA | 37Enterococcus faecalis V583 ASM778v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,542,650 | 1 | CCAGACATCTTTATCCAGATGACAAAGATATTTTCTCACATGTTCTTTTCTTGGTAAAATTGGGGTAGTTTTAAGGGTCACACCTAGGACTGCACCCATCTGAGTTCACTTGGGTCTGGAATTGACTTTTTGTCATACAGCGAGCCGTTC | 120homo sapiens
|
G000010425 | ASM1042v1 | GCF_000010425.1 | PRJNA224116 | SAMD00061080 | null | 2006/12/05 | Gifu University, Life Science Research Center, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/425/GCF_000010425.1_ASM1042v1 | 639,633,010 | RS_GCF_000010425.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 367,928 | 1,680 | Bifidobacterium adolescentis ATCC 15703 | strain=ATCC 15703 | null | Bacteria | Actinobacteria | Actinobacteria | Bifidobacteriales | Bifidobacteriaceae | Bifidobacterium | Bifidobacterium adolescentis | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 2,089,645 | 1 | 59.18 | 2,089,645 | 1 | 1,683 | 614,966 | 86.722338 | 100 | 0 | 0 | 284 | yes | yes | yes | 20 | high | 248,040 | 0 | GATTCCGCTGCCGGCGCCTCCGCGCAGTCTGCACAGACCACCCAGTCGCAGTCGTCCGACCAGGCCGAGGAATTCCTCGGCTTCCGCGTGAACCTGCCGTTTGGCATTCCCGCTGGTCCGCTGCTGAACGAGCGGTTCACCACCGCCGCC | 12Bifidobacterium adolescentis ATCC 15703
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,060,750 | 1 | CGTAATCCCAGCACTCTGGGAGGCCCAGGCCGGAGGATCTATTGAGGCCAGGACTTTGAGACCAGCCTGGGCAACATATGAGATCCCGTCTCTACAAAAAATAACAAATTAGCTAGGTGTGGTGGCGCACGCCTGTCATCCCAGCTACTC | 120homo sapiens
|