#genome
stringclasses 121
values | asm_name
stringclasses 120
values | assembly_accession
stringclasses 120
values | bioproject
stringclasses 45
values | biosample
stringclasses 120
values | wgs_master
float64 | seq_rel_date
stringclasses 98
values | submitter
stringclasses 76
values | ftp_path
stringclasses 120
values | img_id
float64 637M
2.51B
⌀ | gtdb_id
stringclasses 120
values | scope
stringclasses 3
values | assembly_level
stringclasses 1
value | genome_rep
stringclasses 1
value | refseq_category
stringclasses 3
values | release_type
stringclasses 2
values | taxid
float64 1.15k
681k
⌀ | species_taxid
float64 7
911k
⌀ | organism_name
stringclasses 120
values | infraspecific_name
stringclasses 112
values | isolate
stringclasses 1
value | superkingdom
stringclasses 2
values | phylum
stringclasses 18
values | class
stringclasses 30
values | order
stringclasses 56
values | family
stringclasses 75
values | genus
stringclasses 89
values | species
stringclasses 117
values | classified
bool 1
class | unique_name
stringclasses 121
values | lv1_group
stringclasses 2
values | lv2_group
stringclasses 13
values | score_faa
float64 0.93
1
⌀ | score_fna
float64 0.88
1
⌀ | score_rrna
float64 0.1
1
⌀ | score_trna
float64 0.6
1
⌀ | total_length
float64 618k
9.12M
⌀ | contigs
float64 1
22
⌀ | gc
float64 22.5
72.2
⌀ | n50
float64 616k
9.03M
⌀ | l50
float64 1
1
⌀ | proteins
float64 525
7.92k
⌀ | protein_length
float64 172k
2.68M
⌀ | coding_density
float64 74
96.9
⌀ | completeness
float64 76.3
100
⌀ | contamination
float64 0
4.4
⌀ | strain_heterogeneity
float64 0
100
⌀ | markers
float64 124
383
⌀ | 5s_rrna
stringclasses 2
values | 16s_rrna
stringclasses 1
value | 23s_rrna
stringclasses 1
value | trnas
float64 14
20
⌀ | draft_quality
stringclasses 2
values | start_position
int64 0
10M
| autotrain_text
stringlengths 150
150
| autotrain_label
class label 2
classes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
G000010345 | ASM1034v1 | GCF_000010345.1 | PRJNA224116 | SAMD00060915 | null | 2007/07/11 | Japan Agency for Marine-Earth Science and Technology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/345/GCF_000010345.1_ASM1034v1 | 640,753,056 | RS_GCF_000010345.1 | Monoisolate | Complete Genome | Full | na | Major | 387,093 | 387,093 | Sulfurovum sp. NBC37-1 | strain=NBC37-1 | null | Bacteria | Proteobacteria | Epsilonproteobacteria | null | null | Sulfurovum | Sulfurovum sp. NBC37-1 | true | Sulfurovum sp. NBC37-1 ASM1034v1 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 2,562,277 | 1 | 43.87 | 2,562,277 | 1 | 2,552 | 795,482 | 91.463999 | 99.59 | 0.61 | 0 | 334 | yes | yes | yes | 20 | high | 936,910 | GAATATGAAGCAGACACTCTCTGACCTGCTGAAACTCTTTTCAAAAGAGAACAGTCCGGCTAAGTTGAAAGCTATGGACAGCGGAGAACATGCGGAAGTCGCAGCTGTAGAAGAAGAGTAGTCTGCAGGGTGGATCGCATCCACCCTGCG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,245,200 | ATGTACTGGAAGTAATCTTAAGGATAACTCAAAACCACAACTGAAATCAATATCCTAAGAATTCAAAATATTAACCAGACAGATAATTGTATGACTTATTAAAATAATGTACACAAATTCAAAATATAATTTTGCCCTTTATTATTATTA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,835,850 | GCAGTGGAGGAAGGATCACCTTCTGACTTATGGATACACATGCAGAAGTGAGCAATACGTATACCTCACATTTCTGTGGGGTTTTTGTTTGTTTGTTTGTTTGTTTTTGAGAGGGAGTCTGGTGCTGTTGCCCAGGCTGGAATGCAATGT | 11
|
G000010165 | ASM1016v1 | GCF_000010165.1 | PRJNA224116 | SAMD00060942 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/165/GCF_000010165.1_ASM1016v1 | 643,692,011 | RS_GCF_000010165.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 358,681 | 1,393 | Brevibacillus brevis NBRC 100599 | strain=NBRC 100599 (= 47) | null | Bacteria | Firmicutes | Bacilli | Bacillales | Paenibacillaceae | Brevibacillus | Brevibacillus brevis | true | Brevibacillus brevis NBRC 100599 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 6,296,436 | 1 | 47.27 | 6,296,436 | 1 | 5,917 | 1,875,522 | 87.757979 | 99.73 | 0.27 | 0 | 381 | yes | yes | yes | 20 | high | 1,161,810 | TACCGAGGTTCGTCCCTTATCTGAAAACGATCAGGAAGCGGTGTCGCTCATGACAGGCATTCGCCAATTGTGGCTAATGGGTCTGTGCATGCATGATCCTCATATCATGGGGAGCAGCGATTCGGATGATGCTTTCGTGAGTGAGAAGAT | 0no label
|
G000008645 | ASM864v1 | GCF_000008645.1 | PRJNA224116 | SAMN02603244 | null | 1999/12/22 | Genome Therapeutics Corporation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/645/GCF_000008645.1_ASM864v1 | 638,154,510 | RS_GCF_000008645.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 187,420 | 145,262 | Methanothermobacter thermautotrophicus str. Delta H | strain=Delta H | null | Archaea | Euryarchaeota | Methanobacteria | Methanobacteriales | Methanobacteriaceae | Methanothermobacter | Methanothermobacter thermautotrophicus | true | Methanothermobacter thermautotrophicus str. Delta H | Archaea | Euryarchaeota | 0.99 | 1 | 0.9 | 1 | 1,751,377 | 1 | 49.54 | 1,751,377 | 1 | 1,876 | 533,233 | 89.684117 | 100 | 0.31 | 16.67 | 182 | no | yes | yes | 19 | medium | 26,780 | GACAGGGGCAGGTATATGCTCAGAGGATGCCATTGAACTTGAATCCTGTGGTGTATCAGCCATAGATGTTGCAGGTGCAGGCGGCACCAGCTGGGCTGCCGTGGAAACATACCGGGCGGATGACAGGTACCTCGGAGAACTCTTCTGGGA | 0no label
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Nostoc sp. PCC 7120 ASM970v1 | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 744,250 | ATCTGTTGCGGCGTTAGAATCACCCTTCCGCGCTTTCCAACCTTCAAGCACCAGCCCGGATACCTCAGTAACTAAGATTGACAAAACTAAAAAATCATCAATCTGTCCCACCACGGGAAGGAAATCTGGAGCAATATCAATTGGGCTGAC | 0no label
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Nostoc sp. PCC 7120 ASM970v1 | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 1,678,560 | GCAAGAAAACCCAACATCATCAATACTTTGTTGGGTTGCGCTATGCTTAACCAAACCTACCTTTTCCTTAACTGAATCCCTTAGGTTTGATCCTATCTTTCAGATATATGAATTTTTAGATTAATAGTTTCTTGCAAACTGCCTAAGTAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,306,300 | AGCAGCGTTTCCCGTCAGGCACTTTGATAGGTCATTTTACTTTCAACAACTAAACAAAGTTTCCTGGGAAGACTGAGAGTCAAAAGAAACTACATTTGAAAGTGTGGCGTAAATAAGAAAACAAAAAAACAAAACTTGACTTGAGCAGTC | 11
|
G000010425 | ASM1042v1 | GCF_000010425.1 | PRJNA224116 | SAMD00061080 | null | 2006/12/05 | Gifu University, Life Science Research Center, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/425/GCF_000010425.1_ASM1042v1 | 639,633,010 | RS_GCF_000010425.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 367,928 | 1,680 | Bifidobacterium adolescentis ATCC 15703 | strain=ATCC 15703 | null | Bacteria | Actinobacteria | Actinobacteria | Bifidobacteriales | Bifidobacteriaceae | Bifidobacterium | Bifidobacterium adolescentis | true | Bifidobacterium adolescentis ATCC 15703 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 2,089,645 | 1 | 59.18 | 2,089,645 | 1 | 1,683 | 614,966 | 86.722338 | 100 | 0 | 0 | 284 | yes | yes | yes | 20 | high | 721,760 | TCGGCAATCCGCTGATCGAACTGACCGATTACTTCAAGAACACGCCGTTCCGCGTGTTCCAGGCCCCATACGTCGGCGCGGTGCTCTTCAAGGGTGGCGCGGCCACGCCTCGCCGTCAGTTCGACGCATGGCAGGATTGGGCCAAGCAGC | 0no label
|
G000009185 | ASM918v1 | GCF_000009185.1 | PRJNA224116 | SAMEA3138195 | null | 2006/06/22 | Max Planck Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/185/GCF_000009185.1_ASM918v1 | 637,000,129 | RS_GCF_000009185.1 | Monoisolate | Complete Genome | Full | na | Major | 362,976 | 293,091 | Haloquadratum walsbyi DSM 16790 | strain=DSM 16790 = HBSQ001 | null | Archaea | Euryarchaeota | Halobacteria | Haloferacales | Haloferacaceae | Haloquadratum | Haloquadratum walsbyi | true | Haloquadratum walsbyi DSM 16790 DSM 16790 = HBSQ001 | Archaea | Euryarchaeota | 1 | 0.997 | 0.9 | 1 | 3,179,361 | 2 | 47.86 | 3,132,494 | 1 | 3,071 | 845,315 | 78.317152 | 99.3 | 0 | 0 | 220 | no | yes | yes | 19 | medium | 787,410 | CTATCACACTGTATGGTGATGCGCTCGTCGTCGATGGGCTGAGCCTGTTCTTTATATTGATTTTCACTATTGTGACTACGATGGTTGCAGTTGCCTCGTATGATTATATTAGCGCTCAGCAATACAAGGCTGAATTCTACTCACTCATAT | 0no label
|
G000007385 | ASM738v1 | GCF_000007385.1 | PRJNA224116 | SAMN02603680 | null | 2005/02/02 | NIAB, Rural Development Administration | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/385/GCF_000007385.1_ASM738v1 | 637,000,346 | GB_GCA_000007385.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 291,331 | 347 | Xanthomonas oryzae pv. oryzae KACC 10331 | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas oryzae | true | Xanthomonas oryzae pv. oryzae KACC 10331 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,941,439 | 1 | 63.69 | 4,941,439 | 1 | 4,831 | 1,427,680 | 85.113992 | 99.82 | 0 | 0 | 355 | yes | yes | yes | 20 | high | 2,825,550 | CTGGAACGACAGCTTGCCGCCGGCCTGCAGATACAGCGGCTTGCTGGTCGACGCGCAGCCCTTGTCGCAACTGCGCGGCCACGCTTTCAGGCGATCCCAGTGGTTTTCGCCGGTGTTGTAGATGAACACCGGCGGCGTGTTCGCCTTCGG | 0no label
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2 | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 5,958,550 | AGGAGGCTCTGCACTCCATGGCGAACGCGTACACCAGGGTCATCGCGGAGCGCCCGGAGCAGCTGCTGATGCAGATGCAGACGTACGTCGCCTCGGCGGCCGCCGAGGAGGCCGGGGACCACGAACTCGCTGAGGCGGTGCGGGCGGGCT | 0no label
|
G000006785 | ASM678v2 | GCF_000006785.2 | PRJNA57845 | SAMN02604089 | null | 2014/04/01 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/785/GCF_000006785.2_ASM678v2 | 637,000,291 | RS_GCF_000006785.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 160,490 | 1,314 | Streptococcus pyogenes M1 GAS | strain=SF370 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus pyogenes | true | Streptococcus pyogenes M1 GAS SF370 | Eubacteria | Firmicutes | 1 | 1 | 0.6 | 1 | 1,852,433 | 1 | 38.51 | 1,852,433 | 1 | 1,776 | 539,188 | 85.75128 | 100 | 0 | 0 | 277 | yes | yes | yes | 20 | high | 1,534,650 | ACCGCGGCGTCTTCTTAAACGAAGATGGTACAGTTAACACTAGCCAAGTGGAATTCTTCTCACCAGGTGCTAACCCATCTAACAAAGCAAAAGGTGGCTGGTTACAAAACCTTAACTCACTTGCTAAACTGGAATTCTCACATGCTAACG | 0no label
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2 | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 4,419,740 | CTGGACATGGTCACCGGCTCCCTCACGGCGGGTCACCCGCGTGAGCTGTGCGAGCAGGCCGCTTTCGCGCTCCTCGACTACATCGAGGAGTACACGGACGGCTTCCGCATCCTGGTCCGCGACTCGCCGATCCCCCAGTCGACGGGTTCG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,539,550 | TAAAACAACAGCTGCAGGTGAAGCTATTTCGCCGGCTGCATCACCGCAGCCACCCCCTCTTCTGTCGGGCACCGTGGGAGGGTGGGGGCGGGGAGAGCATCGGAGTGGTGAAAAGAGGTGCGATCAAAGCACAGCCGGGTTTCTGTTCCT | 11
|
G000010065 | ASM1006v1 | GCF_000010065.1 | PRJNA224116 | SAMD00061073 | null | 2004/12/16 | Nagoya University, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/065/GCF_000010065.1_ASM1006v1 | 637,000,307 | RS_GCF_000010065.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 269,084 | 32,046 | Synechococcus elongatus PCC 6301 | strain=PCC 6301 | null | Bacteria | Cyanobacteria | null | Synechococcales | Synechococcaceae | Synechococcus | Synechococcus elongatus | true | Synechococcus elongatus PCC 6301 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 2,696,255 | 1 | 55.48 | 2,696,255 | 1 | 2,691 | 815,460 | 89.10092 | 99.73 | 0 | 0 | 342 | yes | yes | yes | 20 | high | 1,942,980 | CACTGCGGAGTGCTATTCAGCCTAATGAGAGGTCGATCGCTAAAACTTAGCTTTCGCGTAGGACATAACCGACGCCGCGCACCGTTTGCACAAGCCGTTTTTCGCCTTCGATCTCAATCTTGAGGCGCAAGTAGCGAATGTAGACCTCAA | 0no label
|
G000009545 | ASM954v1 | GCF_000009545.1 | PRJNA224116 | SAMEA3138207 | null | 2009/01/28 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/545/GCF_000009545.1_ASM954v1 | 643,348,578 | RS_GCF_000009545.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 218,495 | 1,349 | Streptococcus uberis 0140J | strain=0140J | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus uberis | true | Streptococcus uberis 0140J | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 1,852,352 | 1 | 36.63 | 1,852,352 | 1 | 1,807 | 559,733 | 89.025412 | 100 | 0 | 0 | 291 | yes | yes | yes | 20 | high | 782,470 | AAAAAAATACAAAGGTGTTTATTGTGATAAGAATGGTAAAATATTTTATCAAGCTGATCTTGGTGTTGACCCTGTAACAGGTAAACGAGTTCAAAAGAAAGCTAGAAAGAATCAGTATGGTAAGCCATTTAGTACAATGAAAGAAGCGTA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,301,850 | ATGCCGTGATTCATGTAATTTTTGAGTGGTTACTTTGGTGCAGTTTGTCAATTTGCTCTACCATACTGTTTTTTGATTATTTGTTTGTTTTCTAGTGTAAATAGCACAGCCCACATAAATGAGCGAAACTCATCATCTGAGGATCTTTGA | 11
|
G000007005 | ASM700v1 | GCF_000007005.1 | PRJNA224116 | SAMN02603227 | null | 2002/11/25 | European/Canadian Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/005/GCF_000007005.1_ASM700v1 | 638,154,518 | RS_GCF_000007005.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 273,057 | 2,287 | Sulfolobus solfataricus P2 | strain=P2 | null | Archaea | Crenarchaeota | Thermoprotei | Sulfolobales | Sulfolobaceae | Sulfolobus | Sulfolobus solfataricus | true | Sulfolobus solfataricus P2 | Archaea | Crenarchaeota | 0.96 | 1 | 1 | 0.9 | 2,992,245 | 1 | 35.79 | 2,992,245 | 1 | 3,281 | 874,971 | 86.125133 | 100 | 0 | 0 | 196 | no | yes | yes | 14 | medium | 2,525,510 | ATTTACCGAGTATTTAAAGACTATCGATATAATTGATAATGTTAAGATACATTCTATACAAATAAATAATGCATTAAAGGAAATTAATGATGAAGGTTGGAGGAGCCTTGATTCCCTCGAGGAGATTTACGCATGAGCTGCTCTTGGCGA | 0no label
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Pseudomonas putida KT2440 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 2,442,180 | ACACCCGTGTGCTGCCGCAGCAGAGCAAGCCGGGCGAAGACGACGTGCTGCCAGAGATGGTGCAGGGTGAAGCACTCAAGCTGATCCAGATCGACCCGAGCCAGCACTTTACCAAGCCACCTGCACGCTTTACCGAAGCCAGCCTGGTCA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,202,500 | AGGTGGATCCAGAAGCCTCGGGTGGAGAGGCCAGTGTCGCTGCCTGGCCAGCCGAGAAGCCTGGGGACCTGGGGGACTCTAGTACAATCTTTTCCCTTGAATGGAGCAGATGTCACCATGTGACTCACCCTCTCGGGGGACTCCACCAAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,776,650 | TTTACAAGGGGATGGGCGCATGAAACCATTTGAGACTGTTTCGAAACACCTGTGTTAGGACCCACCCTACACCTACTGGATCAGAATGTCTCTGTCTTGAGAAAGGGAGCAGGAGGCGAGGACCGCGTGTTTGTTCTGATGCCCTCCTTT | 11
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Sinorhizobium meliloti 1021 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 3,664,830 | GGGCCGAACAGACGGCGGGGCGCCTGGTGCTCGAAGGCGCCTTCGTCCGATTGCCGGGCCACGAGGTCCGGTTGAGCGAAAAGGAGGAGGAACTCTATGCCCGAATTCTTCCACATCTGGAAGGCGAGGAGAGATTCCGTCCGCCTCGAG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,942,600 | TTCCTCTGGGAAGGAAAGAGGGGCTAGATATTGAGTCAGTAATCCATCAGGCCTATGGGATAAAGTCGACATGAAAACCCCTAAACTATGGGGTTTGGAGAATTTCCATATGACCAAACATGTGGGTGCGCCTGTAGGGTGCAGCTCTGT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 163,050 | CATTGTGAGTCATGAGCTTGGTCTGTAGAGGCTGACTGGAGAAAGTTCTCGGCCTGGAGAGGCTGCCGGGAGGTAGGAGCTGGGCCAAAAGATGTAAGCACATTTGCATTTATTAGGCACTTTATTTCCATTATTACACTGTAATATATA | 11
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Pseudomonas putida KT2440 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 1,442,220 | GTCAGCGCATTGGGCAGCTTGAACAGCGGCGAGTCGCTCAGCGGTTCTTTCTCGTACACATCCAGGCCTGTGCCGCGAATGGTGCCCGCCTGCAGCGCCTCGATCAGCGCCGCCTCATCCACCACCGGCCCACGGGCAATGTTGATCAGG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,239,750 | GCAGGAGAGTCGCTTGAACCAGGGGGGTGGAGGCTGCAGTGAGCAGAGATCGCGCCACTGCACTCCAGCCAGGGCGGTAAGAGCAATGCTCCGTCTCAAAAACACAAAAAAACCCACACGTATTGGAAGGAAAACACTGCATTATCCTGT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,568,000 | TAATGCCTGCTTGGGGGTGTGCAGTACTGATACGACGTGGATCAGTGACATCTTTCTGATATGTTTTTCTGTTGGTGAATTAACAAACCGGGCACCTGGCGAGAGACTGTGCCCCAGCAGGATGTGACATCAAGATGCCAGGCTTAGGGC | 11
|
G000010625 | ASM1062v1 | GCF_000010625.1 | PRJNA224116 | SAMD00060936 | null | 2008/01/24 | Kazusa DNA Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/625/GCF_000010625.1_ASM1062v1 | 641,522,640 | RS_GCF_000010625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 449,447 | 1,126 | Microcystis aeruginosa NIES-843 | strain=NIES-843 | null | Bacteria | Cyanobacteria | null | Chroococcales | Microcystaceae | Microcystis | Microcystis aeruginosa | true | Microcystis aeruginosa NIES-843 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 5,842,795 | 1 | 42.33 | 5,842,795 | 1 | 5,605 | 1,591,543 | 80.239081 | 99.89 | 0.51 | 25 | 350 | yes | yes | yes | 20 | high | 328,120 | GTCACCACCCGGGGGCCGTCCGCAACAACGTGGGCGTTGGTAATGATGATACCGTCGGGACTGACCAGAAAGCCGCTACCGTGGCCGCTGCCATTTTTGACGGTGACGACGGCGGGGCTGGCTTTCTGATAGACTCTAGAAGCGGTCTGC | 0no label
|
G000009125 | ASM912v1 | GCF_000009125.1 | PRJNA224116 | SAMEA3138192 | null | 2003/05/06 | Genoscope | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/125/GCF_000009125.1_ASM912v1 | 637,000,231 | RS_GCF_000009125.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 267,608 | 305 | Ralstonia solanacearum GMI1000 | strain=GMI1000 | null | Bacteria | Proteobacteria | Betaproteobacteria | Burkholderiales | Burkholderiaceae | Ralstonia | Ralstonia solanacearum | true | Ralstonia solanacearum GMI1000 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 5,810,922 | 2 | 66.98 | 3,716,413 | 1 | 5,062 | 1,725,241 | 87.482692 | 99.94 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 442,000 | GTTCTTCGTCACCGTGGGCATGCTGCTCGACCCGCGCGTGGTGATCGGGCACTGGGGGCTGGTGATCGGGCTGGTGATCGGGCCGGTGCTGTTCAAGTTCGCGCTGATCGCCTTGCTGGCGCGCGCCTTCGGCTCGGGCGGCGGCACGGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,889,050 | TGTTTGTTCGTGTTGTTGCAGCTCTTGAAGACAACCAGTCCCTGATTGGGCTCTGCCCCAGTGAAACCCACGAGTGTCCTAGCAGGATGGTCACCTAGGATTTTGATGGTGCCACACACAGAGAACCCTGAGGACTGAGGCCATGGAGCA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,787,250 | TTGTCACATAAAATCTCCAAATATTCCTTGGGCCCCTCTTTGGGCACTGTGTAGAATGTTGGCTGAAGTAGGGAGGAAAAAGCCATAATCCCTGTCCTTGTGGGGTAGGAAGGTTGATCAGCAATATTGAAATAATTACCCAAATATGTC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 439,650 | AAAATACAAAAAATTAGCCAAGCGTGGTGGTGGGCGCCTGTAGTCCCAGCTGCTCGGGAGGCTGAGGCAGGAGAATTGCTTGAGCCCTGGAGGCGGAGCTTGCAGTGAGCTGAGATGGCACCACTGCACTCCAGCCTGGGCGACAGCAAG | 11
|
G000009905 | ASM990v1 | GCF_000009905.1 | PRJNA224116 | SAMD00061067 | null | 2004/09/02 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/905/GCF_000009905.1_ASM990v1 | 637,000,306 | RS_GCF_000009905.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 292,459 | 2,734 | Symbiobacterium thermophilum IAM 14863 | strain=IAM14863 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Symbiobacteriaceae | Symbiobacterium | Symbiobacterium thermophilum | true | Symbiobacterium thermophilum IAM 14863 IAM14863 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 3,566,135 | 1 | 68.67 | 3,566,135 | 1 | 3,297 | 1,051,001 | 86.832243 | 98.02 | 0.03 | 0 | 347 | yes | yes | yes | 20 | high | 361,010 | GGGTAGTTCGAGAATCTCGCCGTGAAACCCCTTGATCAGGTAGCGGTCGGCGAGGTGCAGGAGCCCGACATAGGTGAAGAGCTCGTCCCGTTCCGGGCGAATATACCGCCCCAGTTCCCGAATCTCTTCCTCGCTGTAGGCCTCGATCAT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,072,450 | TATAGGGCGAGGAACTGGGTCAGGGTGGGGGAGCTGAGTCGGGGTGGGGGAGCTGAGTCGGGGGTGCAGAAGGGCTGAGTCGGGGTGGGGGAGCTGAGTCAGGGGTGCAGGTGTCTTGACTGTATCCTAGAGATGTTTTTTGCCAGCTTT | 11
|
G000009745 | ASM974v1 | GCF_000009745.1 | PRJNA224116 | SAMD00061075 | null | 2003/10/03 | NHRI, Taiwan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/745/GCF_000009745.1_ASM974v1 | 637,000,337 | RS_GCF_000009745.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 196,600 | 672 | Vibrio vulnificus YJ016 | strain=YJ016 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Vibrionales | Vibrionaceae | Vibrio | Vibrio vulnificus | true | Vibrio vulnificus YJ016 | Eubacteria | Proteobacteria | 1 | 0.996 | 1 | 1 | 5,260,086 | 3 | 46.68 | 3,354,505 | 1 | 4,639 | 1,553,759 | 87.03525 | 100 | 0.14 | 0 | 369 | yes | yes | yes | 20 | high | 801,710 | ATTCATTTAAAAAGATTGAGTTCTTATGACAATTCAATCTAAAACAAGAAAGCTGATACAGGACATTTACCCTGCCTCACTATCTATTAGTAGCGATTTTAACACATCGGGAGAAGACGGTAGCATTCCGACTTTTAAGCCAAATGGTTT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,560,400 | ACCACGCCTGGCCAATTTTTTTGTATTTTTAGTAGAGATAGGGTTTCACCATATTAGCCAGGATGGTCTTGATCTGCTGACCTCATGACCCACCCGCCTCGGCCTTCCAAAGTGCTGGGATTACAGGTGTGAGCCACCGCGACCGGCCTG | 11
|
G000007705 | ASM770v1 | GCF_000007705.1 | PRJNA224116 | SAMN02603528 | null | 2003/08/22 | LNCC, Brazil | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/705/GCF_000007705.1_ASM770v1 | 637,000,074 | RS_GCF_000007705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 243,365 | 536 | Chromobacterium violaceum ATCC 12472 | strain=ATCC 12472 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Chromobacteriaceae | Chromobacterium | Chromobacterium violaceum | true | Chromobacterium violaceum ATCC 12472 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,751,080 | 1 | 64.83 | 4,751,080 | 1 | 4,298 | 1,428,392 | 88.582238 | 99.04 | 0.45 | 0 | 372 | yes | yes | yes | 20 | high | 3,962,270 | GGCGATCCAGACCGACTGCGGCGATTTCCTGCTGAAACTGGAAGCGCGCGAGAAGGAACGCACCGGCATCACCACGCTGAAGGTGGAGTTCAACCGCGTGCACGGCTTCTACATCGAGGTGTCCAAGGCGCAGTCGGACAAGGTGCCGGA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,272,350 | ATTCCAAACCCATATAGGACAGGCACTTGGATATCTGAGTGTTCTGCACTTAAAATTGGTCATGTCCCAAACTCTGTCCATCTCTCTCCCCAAATATGCTCTCTCTTTATGATTCTAACAGAACACTCTATGTCCAGTCATAGCCTAAGT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 123,150 | TAAAAGAAAATAGGTACATACAAAATATCACATAGAGAGAAATATTAATACCATGAAAATATTAAAATAAAAGCATAAAATTAATTCATTTATTTACCCTATTAGTATTTTTTGAACACCTATGTGCCAGGTATTGTGCTGAATGCCAGT | 11
|
G000007805 | ASM780v1 | GCF_000007805.1 | PRJNA57967 | SAMN02604017 | null | 2003/03/05 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/805/GCF_000007805.1_ASM780v1 | 2,508,501,074 | RS_GCF_000007805.1 | Multiisolate | Complete Genome | Full | reference genome | Major | 223,283 | 251,701 | [Pseudomonas syringae] pv. tomato str. DC3000 | strain=DC3000 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas syringae group genomosp. 3 | true | [Pseudomonas syringae] pv. tomato str. DC3000 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.9 | 1 | 6,538,260 | 3 | 58.34 | 6,397,126 | 1 | 5,862 | 1,948,843 | 87.825109 | 100 | 0.22 | 0 | 381 | yes | yes | yes | 20 | high | 3,842,670 | ACTTTGCCGCATCGTTGACACGCGCCCGGTTCTGAAGTCGCCTGTAAGCCCCCAGCTCGAGCAATTTGGTGACCGGGTCGCTTTCCAGCAAGGCGCTCCAGTTGTCACCCATGTATTCGCGAAAGGCGGATAGCTCGCCCTGATACTCTT | 0no label
|
G000007845 | ASM784v1 | GCF_000007845.1 | PRJNA57909 | SAMN02603432 | null | 2003/04/30 | J. Craig Venter Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/845/GCF_000007845.1_ASM784v1 | 637,000,014 | RS_GCF_000007845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 198,094 | 1,392 | Bacillus anthracis str. Ames | strain=Ames | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Bacillus anthracis str. Ames | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,227,293 | 1 | 35.38 | 5,227,293 | 1 | 5,474 | 1,495,110 | 84.244541 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 425,880 | TCTTGGACGACGCCGATAACAGCATTTAAAACTACAACAAGCGCAATAATACTTGCATCAGCCCATTCACCTACAAAGGCAGAAATAAGGGCAGCAATAATAAGGACATATACGAGGACGTCATTAATTTGGGCAAAAATACGCTGCCAT | 0no label
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Nostoc sp. PCC 7120 ASM970v1 | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 5,962,060 | TAAATTCTGTCTCAATCACATTCCATTCATGGGAATCTAGCAATGGCTCAAGGGAATTTTCCACCGATATATCTACGTCGTCAAGCATGAGTTAGAAAACCTAAAATTTGCAGATGGCTGTTGTCAAGATGAAACATAATCGATAGGATT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,234,550 | AAACTACCCTGTAGGAGCAGCCAATGCATTCTGACCTAACAGCTGTACACAGTTGCACTAGTTAAAATGAAAAGCTAGTCTGCATCACACACAGGCAATTCACTGAGCCTTACTGATACGTTGATGGGGTTTACCATCACAGTCTTCCCT | 11
|
G000006985 | ASM698v1 | GCF_000006985.1 | PRJNA57897 | SAMN02604006 | null | 2002/07/02 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/985/GCF_000006985.1_ASM698v1 | 637,000,073 | RS_GCF_000006985.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 194,439 | 1,097 | Chlorobium tepidum TLS | strain=TLS | null | Bacteria | Chlorobi | Chlorobia | Chlorobiales | Chlorobiaceae | Chlorobaculum | Chlorobaculum tepidum | true | Chlorobium tepidum TLS | Eubacteria | FCB | 1 | 1 | 0.8 | 1 | 2,154,946 | 1 | 56.53 | 2,154,946 | 1 | 2,009 | 639,065 | 87.375415 | 98.9 | 0.55 | 0 | 334 | yes | yes | yes | 20 | high | 1,870,830 | GGCCGCCGAGCAGAATCCCGGCGAGGCGTTCGGCAAAAGCGCGAAAGTCTATAGCCCATACGTGCTCTTGCGAACGCTTCAGGCGTGGAGCGGCGTGGAAGCGCTTTCGCTGCCGGGCGACATTCGCGACCTGCTCGAACGCACCTACGA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,002,850 | AGTGACATCTCTGTGAAGGGCCTGTGAGCATGCCCTCTGGAGTGAACACTCACCTCGCTCACAGCGGACGCCGGCTCTCCCCGGGGGGCAGAGGCAGGTGCCGGTCACAGGGTCGCAGGCCGCCCCCTGCCCACACCCACACACGTGGGT | 11
|
G000009125 | ASM912v1 | GCF_000009125.1 | PRJNA224116 | SAMEA3138192 | null | 2003/05/06 | Genoscope | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/125/GCF_000009125.1_ASM912v1 | 637,000,231 | RS_GCF_000009125.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 267,608 | 305 | Ralstonia solanacearum GMI1000 | strain=GMI1000 | null | Bacteria | Proteobacteria | Betaproteobacteria | Burkholderiales | Burkholderiaceae | Ralstonia | Ralstonia solanacearum | true | Ralstonia solanacearum GMI1000 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 5,810,922 | 2 | 66.98 | 3,716,413 | 1 | 5,062 | 1,725,241 | 87.482692 | 99.94 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 3,807,440 | GCATAGCCCGATCGCTCAAGGATCGACTCCACATCATCGAGCGGATCGAGGAGAAGAGAGCCCAGTTTCGATCGTTCACCGAGTCGCTCGACACGAGCCTGCCAGCAGGGCGAATGCTCCTCCACATGGTCGGAGCCTTTGCCGAGTTTG | 0no label
|
G000007865 | ASM786v1 | GCF_000007865.1 | PRJNA224116 | SAMN02604086 | null | 2004/01/30 | Univ. Minnesota | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/865/GCF_000007865.1_ASM786v1 | 637,000,168 | RS_GCF_000007865.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 262,316 | 1,764 | Mycobacterium avium subsp. paratuberculosis K-10 | strain=K-10 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Mycobacteriaceae | Mycobacterium | Mycobacterium avium | true | Mycobacterium avium subsp. paratuberculosis K-10 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 4,829,781 | 1 | 69.3 | 4,829,781 | 1 | 4,544 | 1,497,326 | 91.345322 | 99.28 | 0.33 | 0 | 336 | yes | yes | yes | 20 | high | 2,763,670 | CGGGGCCGGTCTTGCACCGGCCCGATCGGAGCAGCCTCCGACGGACCGGTCGCCTGCGCGGCTTTTTGGGGTTCTACCTGCACCGTACCACAGGCCGAAGCCCACTACTACTGCCTGTCGTACTCTTCGTCTTCGTAGTCGTCGCCGCGG | 0no label
|
G000010165 | ASM1016v1 | GCF_000010165.1 | PRJNA224116 | SAMD00060942 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/165/GCF_000010165.1_ASM1016v1 | 643,692,011 | RS_GCF_000010165.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 358,681 | 1,393 | Brevibacillus brevis NBRC 100599 | strain=NBRC 100599 (= 47) | null | Bacteria | Firmicutes | Bacilli | Bacillales | Paenibacillaceae | Brevibacillus | Brevibacillus brevis | true | Brevibacillus brevis NBRC 100599 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 6,296,436 | 1 | 47.27 | 6,296,436 | 1 | 5,917 | 1,875,522 | 87.757979 | 99.73 | 0.27 | 0 | 381 | yes | yes | yes | 20 | high | 3,123,250 | TATCGAGGATATCTATACACTTTCTCCGCTCCAACAGGGGATGCTGTTCCACTCCCTGTATGCAAGCGACAGCGGGGATTACGTCGTCCAATTTGCGATTGATTTCAAAAACCTGAATGTGCCGGTGTTCGAGCAAGCATGGCAAAAAGT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,660,200 | GCCTTAACCCGCGGCCTGCCAGTATGGTGGCCCGCGTGGGCGACTGGCCTGGGCAGCTGCTGGGCGGGGCTGGAGGGTGGAAGGCCAGCAGGCGGGAGACACCCCCCACCCTCTTCCCTGCCAAGCTCAGGGAGAAAAGTGGACCCTGGT | 11
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2 | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 4,108,390 | GACTCCAGGCCGCGGTCCAGCATCGCGTGGTGCAGCGCCTCGGTGCGCGGGCGGTTGAAGCCCTGGTTGTAGTAGAGCTTCTGCGGCTGGAAGGCCGGACCGTACTCCGACTCCGGGTACTTCTCGGTGTCCGCCGCGCCGTCGAACGCC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,708,550 | CCTGGGTGACAGAGCGAGACTGTCTCAAAAATAGAAAAAAAAAAAACTTTTTCCAAGAACAGAGTGGAAAAAGCTCATCGTCTTCTGCACATACCATACTCAATTTCCATTCCAGGACTAAATGAACTCCTCATCCAGGAACCCCCAAGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,081,250 | TGTTAGTGAAATAAAATAAAAACATGGAGATAACACTTCTCACCTATCAGACTTGTAAAAATTTAAAAAGACAAAACATTCTATTAGGAAAACAGGCTGCTTCATACTTATCAGAAGGAACACAAATTGGTACATGCCAGCTGAAGGGAA | 11
|
G000009145 | ASM914v1 | GCF_000009145.1 | PRJNA224116 | SAMEA3138193 | null | 2003/05/06 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/145/GCF_000009145.1_ASM914v1 | 637,000,195 | RS_GCF_000009145.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 228,410 | 915 | Nitrosomonas europaea ATCC 19718 | strain=ATCC 19718 | null | Bacteria | Proteobacteria | Betaproteobacteria | Nitrosomonadales | Nitrosomonadaceae | Nitrosomonas | Nitrosomonas europaea | true | Nitrosomonas europaea ATCC 19718 | Eubacteria | Proteobacteria | 0.98 | 1 | 0.9 | 1 | 2,812,094 | 1 | 50.72 | 2,812,094 | 1 | 2,670 | 848,291 | 88.875656 | 99.97 | 0.74 | 25 | 352 | yes | yes | yes | 20 | high | 1,361,880 | ATGATGCCCATGCCCACCTGCGTGCGCCACATTTTTGCCCAGACGGCCGGATCGTCATTGATGTTGCGCACAATCGGAGCCTGGGCGCGGATCACCACGCCTGCCGCACGGATGCGCCTGACCGCCTCACGCACAATGGGTGTATCCATT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,894,800 | ACACTTTGCTCCCTCATTCTGAGTTCCATCTCCAGGAGCAAAAAGCTCTAGAAGGGTCAACTGGGGCCAAGAAGGAACACGTATCTGGGGGTGGGAATGAGAGCCAGCCCTCTGCACCTGTGGGTTTGCATCCTCAGATTCAAGCAACCA | 11
|
G000009865 | ASM986v1 | GCF_000009865.1 | PRJNA224116 | SAMD00061066 | null | 2005/06/30 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/865/GCF_000009865.1_ASM986v1 | 642,555,160 | RS_GCF_000009865.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 279,808 | 1,283 | Staphylococcus haemolyticus JCSC1435 | null | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus haemolyticus | true | Staphylococcus haemolyticus JCSC1435 | Eubacteria | Firmicutes | 1 | 0.989 | 1 | 1 | 2,697,861 | 4 | 32.78 | 2,685,015 | 1 | 2,600 | 785,925 | 85.820989 | 99.62 | 0 | 0 | 341 | yes | yes | yes | 20 | high | 2,159,040 | AAATCACTTAACCTCACTTATTGAATTTCTTATTATAATTCCCTTTGTTGGGTTTAATGTTATGTTATTAAAAAAACTGAGAAAAGCTCGATGTGAGCGTATTCTCAGTTAAGTCATTTAATACGAGATGCCTATGATTCCTTAAATTAC | 0no label
|
G000006925 | ASM692v2 | GCF_000006925.2 | PRJNA62907 | SAMN02603599 | null | 2011/08/03 | Microbial Genome Center of ChMPH | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/925/GCF_000006925.2_ASM692v2 | 637,000,264 | RS_GCF_000006925.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 198,214 | 623 | Shigella flexneri 2a str. 301 | strain=301 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Enterobacteriaceae | Shigella | Shigella flexneri | true | Shigella flexneri 2a str. 301 | Eubacteria | Proteobacteria | 1 | 0.998 | 1 | 1 | 4,828,820 | 2 | 50.65 | 4,607,202 | 1 | 5,003 | 1,415,151 | 86.329724 | 99.7 | 0.21 | 0 | 372 | yes | yes | yes | 20 | high | 1,552,850 | CTATGATTAAAAGCTAAGATTTTTACTGACCACACCTAGGAGAAACGATGCAAGATTCCATTCTGACGACCGTAGTGAAAGATATCGACGGTGAAGTGACCACGCTGGAGAAGTACGCCGGTAATGTGCTGTTAATTGTCAATGTCGCCT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,994,900 | GTACATGGGACAGAATGGGTTGTGACCAGCATCTCCCTAATCTGCCTTGCCCACCCACTCACTACTCTGCACTCACCTGGGCATTGTAAATGGTGTCCACCCAGCCACGGCACAAGGCCTGGCCACTGGCCTGGAACGTGTAGGCCCCTA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,088,150 | AGCTGAGCCTTGCCTGCTTCCTGCCTCTGGGTCGTCTCTGAAAGGGACTAAGGGACTAAAAAACTAAGAGGGACAGGGGGGCGTTTCCATTGTCTCCCAGCTCTGTCGTCTCCCTGCATCTCCTAACCACGCATGCCAGATCAGGGAGCA | 11
|
G000009725 | ASM972v1 | GCF_000009725.1 | PRJNA224116 | SAMD00061113 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/725/GCF_000009725.1_ASM972v1 | 2,514,885,032 | RS_GCF_000009725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 1,148 | 1,148 | Synechocystis sp. PCC 6803 | strain=PCC 6803 | null | Bacteria | Cyanobacteria | null | Synechococcales | Merismopediaceae | Synechocystis | Synechocystis sp. PCC 6803 | true | Synechocystis sp. PCC 6803 ASM972v1 | Eubacteria | Cyanobacteria | 1 | 0.99 | 0.9 | 1 | 3,947,019 | 5 | 47.37 | 3,573,470 | 1 | 3,713 | 1,164,101 | 86.890968 | 99.78 | 0 | 0 | 349 | yes | yes | yes | 20 | high | 1,269,580 | ACCATAGAAATCCAAACTGGGACGACTGTAGGCAAAGGAAGTGTAAATTAGGGTATTAACTGGGGTGCTTTGTTTAATTAACCGCCCCACGGGCTTAACGGCAAAGGCTTCATTCACTTCCCAATTCCAGAGGGGACTGGAAAAAAGAAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,823,450 | ATATAAAATGATTATTTGTTAACACTGTTACCATCTGGAATGATCTCATTTATTGTTTACTATTGGTCTCTCCCACTGAAATGGAAATTCTCTAAGGCCCAGAGCCTGGTCCATGTTGTTTATCACTCTCCAGCATGCAGAACAGCACTG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,678,050 | CTTTGGGAGGCCGAGGTGGGCGGATCACGAGGTCAGGAGATTGAGACCATCCTGGCTAACATGGTGAAACCCTGTCTCTATTAAAAATACAAAATATTAACTAGGAGTGGTGGCGGGCGCCTGTAGTCCCAGCTGCTTGGGAGGTTGAGG | 11
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 2,650,310 | CGCCGGTGACCAGCGCCGGGCCGGTGACGGAGACACGCCAGCCCCGGGGCGACGGCGGGAGGGACAGCTCCGTCGCCCCGGGGCGGGCGGCGGCACGGTAGGCGAGGCGGTAGGAGCGGGTGTCCGCGTCGTACGCCTCGGATCGGACGG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,352,950 | GGCAGGGAGGGAGGGAAGGGGGAGGGAGGGAAGGGGGGTAGGGAGGGAGGGAAGGGAGGTAGGGAGGGAGGGAAGGGGGGTAGGGAGGGAGGGAAGGGGGGTAGGGAGGGAGGGAAGGAGGGGAAGGAGGGGAGGAAGGGAGGGAAGGCA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,260,450 | CTTGCCTGGCCAGAAAATAATATCAAGATTCTTAAAAAGCAACCTTCCTCTTGCTTTTGTGTTTTAGTAAAGTAAAATCAGTTTGATCTGAAGTGAGGACTGAACTGCTGACTGGGTATTGACTGTCTTTTGAGTAGAGCTAAGCTTTCT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,644,850 | GGGTCCCGCCTGCAGAGTCCTCCCCCAGCCGTGGGCTCCGGCCTTAGGATTCCTGGACGTGTCAAGGGCAGATTCGAGGAGAAGGGCACAGCAGGCGTCTGCAGCCCCCATCCCACCCTCTTGCCAATGCCCTTGGGTAATCAGCCTCCT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 487,050 | TTCCTAAATTAGTGTGTGGGTGACAGCACTGCAGAAGCTGAGCCTCAGGGAAGGGCGCGGTGGCTCACACCTGTCATCCCAGCACTTTGGGAGGCTGAGGCTGGAGGATCGCTTGAGGCCAAGAGTGGGAGATCAGCTTGGGCAACATAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,542,350 | GGTGACACTGCAGTGACGCTATGGAGCATGGACACTAATACGTCCCACTGGACTTCTGCGTGAGCCCCAGACAGGAGCTTGACCAGCGTCAACTGGACCTGCTGCATCTGATCCTCTCCCAGAGTGAGGTTTTGAACAGAGATGGGCAGA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 751,800 | ATGTGTGTGACCAGTAAGGCAGGCAGGGAGCAGATCCTGGGGCCTAGAAGCCCCCTGAGGATCAAGGATGGCACAGGCCCCTTGCCAAACGCTGCCGAGACCAAGCAAGGTGGCCCAAGCCCCACAGGCACAGACATGGGACCCTCAAGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,629,450 | CTCTGGAGTGCCCTTGGCCAAGAAGAGGGGTCCATTCAGATGGCTGCAGAGGGGCCTTAGAATTTTATTTTTGGTTTACACTGCATGAGAGTGGCAACGAGAGACTGAAAATATGAAGGAAATCCAAAAAAGATGGAAGAGTGGAAGAGC | 11
|
G000009065 | ASM906v1 | GCF_000009065.1 | PRJNA57621 | SAMEA1705942 | null | 2003/05/06 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/065/GCF_000009065.1_ASM906v1 | 637,000,351 | RS_GCF_000009065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 214,092 | 632 | Yersinia pestis CO92 | strain=CO92 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia pestis | true | Yersinia pestis CO92 ASM906v1 | Eubacteria | Proteobacteria | 1 | 0.994 | 1 | 1 | 4,829,855 | 4 | 47.64 | 4,653,728 | 1 | 4,298 | 1,371,586 | 83.669593 | 99.82 | 0 | 0 | 372 | yes | yes | yes | 20 | high | 1,820,520 | CGTGTTGCCTTGGAGCTGGTTAAAAACGGTGAAGCCGCAGCCTGTGTCAGTGCAGGGAATACCGGTGCGTTGATGGGGTTGGCGAAGATGATGATTAAGCCATTGGAAGGCATCGCGCGTCCGGCGTTAATGACGGTTATCCCCAATCAG | 0no label
|
G000010085 | ASM1008v1 | GCF_000010085.1 | PRJNA224116 | SAMD00061079 | null | 2006/01/10 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/085/GCF_000010085.1_ASM1008v1 | 637,000,270 | RS_GCF_000010085.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 343,509 | 63,612 | Sodalis glossinidius str. 'morsitans' | strain=morsitans | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Pectobacteriaceae | Sodalis | Sodalis glossinidius | true | Sodalis glossinidius str. 'morsitans' morsitans | Eubacteria | Proteobacteria | 1 | 0.993 | 1 | 1 | 4,292,502 | 4 | 54.5 | 4,171,146 | 1 | 5,742 | 1,142,020 | 78.310831 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 2,735,460 | CCGCAAATGATGAACATGCCGGCGGCCGACAAACCGTGGGCGATCATCTGTACCACCGCGCCCTGATAGGCCAGCTGGCTGCCGCTGTAGATGGCGATCAGCACAAAGCCCATATGGGACACGCTGGTATAGGCGATAAGGCGCTTGATA | 0no label
|
G000008325 | ASM832v1 | GCF_000008325.1 | PRJNA224116 | SAMN02603968 | null | 2005/05/18 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/325/GCF_000008325.1_ASM832v1 | 637,000,166 | RS_GCF_000008325.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 243,233 | 414 | Methylococcus capsulatus str. Bath | strain=Bath | null | Bacteria | Proteobacteria | Gammaproteobacteria | Methylococcales | Methylococcaceae | Methylococcus | Methylococcus capsulatus | true | Methylococcus capsulatus str. Bath | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,304,561 | 1 | 63.58 | 3,304,561 | 1 | 3,046 | 1,020,877 | 91.024466 | 99.2 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 1,940,770 | CACCGGCATCCCGATCAACTTCGGCATGTCGGTCACCCTCGGATTCATCGTGGGCGCGGCCATTGCCGGCCAGACCTTCTACAACTTCACCCTGGAAAACATCCGCCAGTTCGGCGTGCTGAAAGCCATGGGGGCGGGCAACGGCACCCT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,326,150 | CACTCTCGATAGCTTTGACCTTTTTGACATTTTTCAAAAATTACATCAAACAACAACATAATATGTATACTTAACAAGTACATATGCAACATTCACCAATATAAGCCATGTATTGGGCCATAAAACAAGTTTCAATAAATTTAAAATATT | 11
|
G000010205 | ASM1020v1 | GCF_000010205.1 | PRJNA224116 | SAMD00060919 | null | 2008/05/29 | Kitasato Institute for Life Sciences | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/205/GCF_000010205.1_ASM1020v1 | 642,555,145 | RS_GCF_000010205.1 | Monoisolate | Complete Genome | Full | na | Major | 334,380 | 784 | Orientia tsutsugamushi str. Ikeda | strain=Ikeda | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rickettsiales | Rickettsiaceae | Orientia | Orientia tsutsugamushi | true | Orientia tsutsugamushi str. Ikeda | Eubacteria | Proteobacteria | 0.99 | 1 | 0.9 | 1 | 2,008,987 | 1 | 30.51 | 2,008,987 | 1 | 2,188 | 522,417 | 76.576503 | 99.51 | 0.49 | 0 | 186 | yes | yes | yes | 20 | high | 1,292,590 | ATCGAACTAAGCAATCTATTAGGCAGGCATGTATTCTTCGATCAATTGGGTTTTTTGAGTATGAAGTTTAAAATACAAGCTGTGCCAGCCATAATAGAACAACAAAATAAGGTGCTTAAAATTAGCGAAATAAGCACCTATTAACCATGT | 0no label
|
G000007105 | ASM710v1 | GCF_000007105.1 | PRJNA224116 | SAMN02603579 | null | 2010/01/12 | Macrogen Inc. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/105/GCF_000007105.1_ASM710v1 | 637,000,356 | RS_GCF_000007105.1 | Monoisolate | Complete Genome | Full | na | Major | 264,203 | 542 | Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 | strain=ZM4 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Sphingomonadales | Sphingomonadaceae | Zymomonas | Zymomonas mobilis | true | Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 ZM4 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 2,056,363 | 1 | 46.33 | 2,056,363 | 1 | 1,753 | 604,103 | 86.562441 | 100 | 0 | 0 | 320 | yes | yes | yes | 20 | high | 1,094,600 | CTTTATTTGCGTCTTCTGATGAAGAAAACTTCCATAATCGATCCGAAGAAAAACCAGCCAGTCGCCATAGTTATAGCAGCAGACAGGGTTTGGCAGCTGCAGATAACACCGATTATAATGAAGGACGTAAAGCGGCTCATACGGTTTCTT | 0no label
|
G000007825 | ASM782v1 | GCF_000007825.1 | PRJNA57975 | SAMN02603340 | null | 2004/07/06 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/825/GCF_000007825.1_ASM782v1 | 637,000,017 | RS_GCF_000007825.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,900 | 1,396 | Bacillus cereus ATCC 14579 | strain=ATCC 14579 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus cereus | true | Bacillus cereus ATCC 14579 | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,427,083 | 2 | 35.29 | 5,411,809 | 1 | 5,541 | 1,546,426 | 83.933929 | 98.18 | 0.58 | 18.18 | 383 | yes | yes | yes | 20 | high | 1,941,420 | ATGGTGATGAAACGTTGGATTTGAAGTTTTTCCCGTTAGACGACATGCCACCGTTATTTTGTAAACAACATGAAGATTGCCTGCAAGATTTATTGGAGAAAAGAGTAGGGGTATATCGTTAACATATAAAAAAGAAGCTAAATGAAGATT | 0no label
|
G000010305 | ASM1030v1 | GCF_000010305.1 | PRJNA224116 | SAMD00060909 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/305/GCF_000010305.1_ASM1030v1 | 643,692,024 | RS_GCF_000010305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 379,066 | 173,480 | Gemmatimonas aurantiaca T-27 | strain=T-27 | null | Bacteria | Gemmatimonadetes | Gemmatimonadetes | Gemmatimonadales | Gemmatimonadaceae | Gemmatimonas | Gemmatimonas aurantiaca | true | Gemmatimonas aurantiaca T-27 | Eubacteria | FCB | 1 | 1 | 1 | 1 | 4,636,964 | 1 | 64.27 | 4,636,964 | 1 | 4,004 | 1,466,180 | 93.177023 | 98.9 | 4.4 | 0 | 353 | yes | yes | yes | 20 | high | 35,100 | GCGTCGTTCAATTCGAGACGCACCACATCGTCCTTGATACCGAGGTGGATCACGCGGCCCTGAAATGCACCGCTCTGCACTTCCCGTCCAATCAACATGAACGCCTTCGGCAAGTCGATCACCACGCTGCCGAGGATCACGTCAGGGGCG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,588,950 | GTTTGCCACAGAAATAATCAAATTTCCTGATCAGTTGCATGATTATTATACGAGCTCTCATCAGACTTTAAACTATGGTAGTTTTAAGTTTCTGTCATTCATAGACAGATATTATTTTACTTTACTTTTTCTCTAGAAGTGTTTGCAGTT | 11
|
G000008925 | ASM892v1 | GCF_000008925.1 | PRJNA58233 | SAMN02604111 | null | 2006/03/30 | University College Cork | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/925/GCF_000008925.1_ASM892v1 | 637,000,143 | RS_GCF_000008925.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 362,948 | 1,624 | Lactobacillus salivarius UCC118 | strain=UCC118 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Lactobacillaceae | Lactobacillus | Lactobacillus salivarius | true | Lactobacillus salivarius UCC118 | Eubacteria | Firmicutes | 1 | 0.986 | 1 | 1 | 2,133,977 | 4 | 33.04 | 1,827,111 | 1 | 2,106 | 630,045 | 86.976336 | 99.48 | 0.52 | 0 | 292 | yes | yes | yes | 20 | high | 1,741,870 | TGGCTGGTGGTGGAAATGGTAAAAGTACATTTTTTAATTGGCTATCGGATGCCGTAGGAATTGACAACATTAGTAACGTATCTTTACAGGATTTGACAGACAATCAACGGCGATTTACTACATCGCGATTGTATCAAAAGAATATGAATT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,641,550 | GTTCTGTCCTGTAGACTATGAACTAGAGTGACGTGTCACTTTTAGATGAAGGCAGTTGAGCCAATGTTCCTCCTCCGTCCCTCTCTTCTCTTGCTCCAGTGACCTTGGAGGCTGTGTATTGCAGATGGCATAGATTAAAGATGGAGTAAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,550,100 | AGTCTTGATCTGATTGTGAAAAATAAAGACACCTCCAAACAGGGATATTTCTGACTAACAGCTGGGGTAGAATCATCGGCTTATTACCTTTTTAAGCTAGCCACCTTCTCTTTGCCCCTAATATGTATGGTCTTTGTGTTTTTTTTTTCT | 11
|
G000009725 | ASM972v1 | GCF_000009725.1 | PRJNA224116 | SAMD00061113 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/725/GCF_000009725.1_ASM972v1 | 2,514,885,032 | RS_GCF_000009725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 1,148 | 1,148 | Synechocystis sp. PCC 6803 | strain=PCC 6803 | null | Bacteria | Cyanobacteria | null | Synechococcales | Merismopediaceae | Synechocystis | Synechocystis sp. PCC 6803 | true | Synechocystis sp. PCC 6803 ASM972v1 | Eubacteria | Cyanobacteria | 1 | 0.99 | 0.9 | 1 | 3,947,019 | 5 | 47.37 | 3,573,470 | 1 | 3,713 | 1,164,101 | 86.890968 | 99.78 | 0 | 0 | 349 | yes | yes | yes | 20 | high | 2,786,940 | TCATCAGATTCCTGTGATGAAACAAGATCTCGATAATCACGGCTTTTGGGAAACAGCAAAAATATGGATTAATCATGACAGAAGTATCCAGCGATTTCGTCCTTATTTTCAGCTGCAAGTGGTGACCATCACCCAACTCCTGGGAGTTAA | 0no label
|
G000007865 | ASM786v1 | GCF_000007865.1 | PRJNA224116 | SAMN02604086 | null | 2004/01/30 | Univ. Minnesota | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/865/GCF_000007865.1_ASM786v1 | 637,000,168 | RS_GCF_000007865.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 262,316 | 1,764 | Mycobacterium avium subsp. paratuberculosis K-10 | strain=K-10 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Mycobacteriaceae | Mycobacterium | Mycobacterium avium | true | Mycobacterium avium subsp. paratuberculosis K-10 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 4,829,781 | 1 | 69.3 | 4,829,781 | 1 | 4,544 | 1,497,326 | 91.345322 | 99.28 | 0.33 | 0 | 336 | yes | yes | yes | 20 | high | 1,258,790 | ACGACACGCTGGACAACGATGCGACCGTCTGGCAGAACATCCGCCACGCCGCACCGGATTCCGGCGAGCAGGACCTGCGCGGCCTGCTGGGGGCGTTCATGTTCAGCGGGCCCCAACTCGACCAACCGGCCGGCACGCTGTCCGGCGGCG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,551,600 | GAAAGTAGAAGGTGAGAGATCTCATAGAACCTCTAAGTTTTAGTCTCAGGCTTACAGAGACCCAGCACAATCCGAGCCAGGCATTGGAAGATCCTCCTGGCTCTCACATAACCCCTATGCACCCTTTAAGACCCAATTCCAAGGACCCTT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,395,500 | GCCTTGGCTCACCTCCGGTGCCACACAGGGACAACCTCTCTTGTCTCAATGAGACCCTTATCAATAGTACAACCCCTGGGTTTGCCAATGTCTGTCCCTTTCAGGTGTGAGGAGGTTAAAAACTTGTTCAGGGTAACCAGGTAGCAACGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,118,350 | CCTCGGACTCTCAGGTACCTTCCTGTAGACAAGGAGACAATGAACAATGTCACTCAAAGCCCCAAAGGCAGCAGCTCACAGAAGTGAGAGCTCCTTCCCCTCCAGGTCACGTGCTGTGAAACTCATGGCCCTAAGGGGAGGCTGAGAACA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,395,550 | TAACAGATGCCGACTTTTCCTGAGTGCTGCTTGCCCAGCTTGCTAATCAGAAGGGGGCTGGCAAGAGTCTGTGAAAGGGGAGTTGTCAGCAGAAGATGCCTTAGTGGCAGTGATGGTGGCAGCCCGCTCACTCCTCTCCCTGCCTGCCCT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,897,850 | TTGGAACAAGGACTTAACTTCAGATCCAGTCTGTTTGGCATCATTATTTTTTTAAAGCCATTTACAGCAGACATTTATTGGCGCTAGTAAACTCAGCTGTTGTTAAGAGGGTTCCCCACCCTCTCAGATCCTTAAACCAAAGGGAAAATT | 11
|
G000007805 | ASM780v1 | GCF_000007805.1 | PRJNA57967 | SAMN02604017 | null | 2003/03/05 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/805/GCF_000007805.1_ASM780v1 | 2,508,501,074 | RS_GCF_000007805.1 | Multiisolate | Complete Genome | Full | reference genome | Major | 223,283 | 251,701 | [Pseudomonas syringae] pv. tomato str. DC3000 | strain=DC3000 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas syringae group genomosp. 3 | true | [Pseudomonas syringae] pv. tomato str. DC3000 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.9 | 1 | 6,538,260 | 3 | 58.34 | 6,397,126 | 1 | 5,862 | 1,948,843 | 87.825109 | 100 | 0.22 | 0 | 381 | yes | yes | yes | 20 | high | 493,740 | GGTTGTGGAGAGATTGATGGCTGAACTGGGTCTGCGCTCCGTTGTTCGACCAAAAAAATACCGTTCCTATAAGGGCACCGTCGGAAAAATTGCACCGAATTTGCTGGAGCGCAATTTCACGGCGCAACGCCCGAACCAGAAATGGGTGAC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,374,350 | CAGGAGAATCGCTTGTACCTGGGAGGTCAAGGTTGCAGTGAGCCAAGATCGTGCCACTGCACTCCAGCCTGGGCAACAGAGTGAGACTGTGTCAAAAACAAAAAAACAAAACACACACACACAAAAATGAGAAAACAACAACTGAGGTCA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,887,950 | TTCCTGGGCACCAAGCTGGAGGGGGTGTCCAGACAGATGGGAGGGTGGTACTCTGCACCCCCGCTCCATGCAGCTCTGACCTCGAGAGCCGCCTCAGCCCGCCCGGCCCCTCGAGAGCCGCCTCGGCCCTCCCAGCCTTCCTACAGCTCA | 11
|
G000006785 | ASM678v2 | GCF_000006785.2 | PRJNA57845 | SAMN02604089 | null | 2014/04/01 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/785/GCF_000006785.2_ASM678v2 | 637,000,291 | RS_GCF_000006785.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 160,490 | 1,314 | Streptococcus pyogenes M1 GAS | strain=SF370 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus pyogenes | true | Streptococcus pyogenes M1 GAS SF370 | Eubacteria | Firmicutes | 1 | 1 | 0.6 | 1 | 1,852,433 | 1 | 38.51 | 1,852,433 | 1 | 1,776 | 539,188 | 85.75128 | 100 | 0 | 0 | 277 | yes | yes | yes | 20 | high | 1,227,980 | TTCTTCCATAGCAATACCTGATGATTCCAGACACGCAACCAGTTCTGGGGTAGCATCTACCGAAAAGAACCCCTCAATTTCTGCTTTATTAGCTCCACGACGAATCACTTCTGTACTAGCACGCGCACCAAGCATCATATTCATAGCATC | 0no label
|
G000007645 | ASM764v1 | GCF_000007645.1 | PRJNA57861 | SAMN02603126 | null | 2002/12/20 | Chinese National HGC, Shanghai | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/645/GCF_000007645.1_ASM764v1 | 637,000,281 | RS_GCF_000007645.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 176,280 | 1,282 | Staphylococcus epidermidis ATCC 12228 | strain=ATCC 12228 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus epidermidis | true | Staphylococcus epidermidis ATCC 12228 ASM764v1 | Eubacteria | Firmicutes | 1 | 0.977 | 0.9 | 1 | 2,564,615 | 7 | 32.05 | 2,499,279 | 1 | 2,354 | 721,937 | 82.93198 | 99.81 | 0 | 0 | 345 | yes | yes | yes | 20 | high | 1,006,330 | TCAAGAACTTATCAATCAACTGAAACATAAATACGAAATTGAATTAATAAAAAATAGATATGAAATAAAAACAACTGATGTGAGTGATGTTTTACAATTATTGAAACAATATCATGTCAATTTCAATAAGATTGAAATTCTTAAAAAATC | 0no label
|
G000010585 | ASM1058v1 | GCF_000010585.1 | PRJNA224116 | SAMD00060930 | null | 2009/01/28 | Juntendo University School of Medicine | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/585/GCF_000010585.1_ASM1058v1 | 643,348,562 | RS_GCF_000010585.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 458,233 | 69,966 | Macrococcus caseolyticus JCSC5402 | strain=JCSC5402 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Macrococcus | Macrococcus caseolyticus | true | Macrococcus caseolyticus JCSC5402 | Eubacteria | Firmicutes | 1 | 0.965 | 1 | 1 | 2,219,737 | 9 | 36.56 | 2,102,324 | 1 | 2,352 | 677,409 | 89.896055 | 96.13 | 1.1 | 0 | 339 | yes | yes | yes | 20 | high | 2,072,980 | TCGAAAAAGCATCCCCAATCATTGATTGAGGATGCTTGTTCATGATTTCTCTAGATTTCCGTTCTTCCTGTTATTGCTTTGGATAACGTCACTTCATCTGCATACTCTAAATCTCCACCTACAGGTAAACCGTGCGCTAGACGTGTCACT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,252,000 | AAACTTTAGATGATACAAAAGTTGATTTAGGCAAATGAGAAACTGTTTTGTTTGGTTTTGTTTTTGAGAGAATCTTGCTGTCACCCAGGCTGGAGTGCAGTGGCACGATCTTGGCTCACTGCAAACTCTGCCTCCCAGGTTCAAGCAATT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,424,600 | GATCTCAGCTCACTGCAACCTCCACCTCCCAGGTTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGCATGCGCCACCACGCCCGGCTAATTTTGTATTTTTAGTAGAGATGGGGTTCCTCCATGTTGGTCAGGCT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,727,150 | ATAACCAGAGTGGGACCAGCACAGGGGTGCAGCCTCCTGTCTCATCGCCCACCTTGTCCACTGCCTTTTTCAACTTTAAACACCGTGAGCAGATGAACGAGGAAGACAGTTTTCCAACCCCATCTGAGGCGTCTCCTCCTTTTACAAATA | 11
|
G000006845 | ASM684v1 | GCF_000006845.1 | PRJNA57611 | SAMN02604088 | null | 2005/02/14 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/845/GCF_000006845.1_ASM684v1 | 637,000,188 | RS_GCF_000006845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 242,231 | 485 | Neisseria gonorrhoeae FA 1090 | strain=FA 1090 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Neisseriaceae | Neisseria | Neisseria gonorrhoeae | true | Neisseria gonorrhoeae FA 1090 | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 2,153,922 | 1 | 52.69 | 2,153,922 | 1 | 2,142 | 609,210 | 83.31778 | 99.82 | 0.21 | 0 | 323 | yes | yes | yes | 20 | high | 1,518,920 | CATGACATGCCCCAAGCCGAAATCAAAATCACAAGGGTAAAAGAGACACTTTGCCCCACAATTCCCCACCAATCGACACTATAAGAAATTTTAAACACTCGGTCAAATCAGGGCATGAAAACTCATTAACATATCTGAAATTTTTATTCT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,627,700 | CCCTTTGCCAGCCTGGGGCTGTGCCTGGGGAAAGGGGTCGGCCCCCTCTTAGCTGGGCCTGGGCCGGTGGAGTCTGCTCCCTCCACACCCCTGAACTCAGACCCCACGGGCCAGTGGGGACCCTCCCTTCCTCTCCAGGGGTGCTTGGGC | 11
|