#genome
stringclasses 121
values | asm_name
stringclasses 120
values | assembly_accession
stringclasses 120
values | bioproject
stringclasses 45
values | biosample
stringclasses 120
values | wgs_master
float64 | seq_rel_date
stringclasses 98
values | submitter
stringclasses 76
values | ftp_path
stringclasses 120
values | img_id
float64 637M
2.51B
⌀ | gtdb_id
stringclasses 120
values | scope
stringclasses 3
values | assembly_level
stringclasses 1
value | genome_rep
stringclasses 1
value | refseq_category
stringclasses 3
values | release_type
stringclasses 2
values | taxid
float64 1.15k
681k
⌀ | species_taxid
float64 7
911k
⌀ | organism_name
stringclasses 120
values | infraspecific_name
stringclasses 112
values | isolate
stringclasses 1
value | superkingdom
stringclasses 2
values | phylum
stringclasses 18
values | class
stringclasses 30
values | order
stringclasses 56
values | family
stringclasses 75
values | genus
stringclasses 89
values | species
stringclasses 117
values | classified
bool 1
class | unique_name
stringclasses 121
values | lv1_group
stringclasses 2
values | lv2_group
stringclasses 13
values | score_faa
float64 0.93
1
⌀ | score_fna
float64 0.88
1
⌀ | score_rrna
float64 0.1
1
⌀ | score_trna
float64 0.6
1
⌀ | total_length
float64 618k
9.12M
⌀ | contigs
float64 1
22
⌀ | gc
float64 22.5
72.2
⌀ | n50
float64 616k
9.03M
⌀ | l50
float64 1
1
⌀ | proteins
float64 525
7.92k
⌀ | protein_length
float64 172k
2.68M
⌀ | coding_density
float64 74
96.9
⌀ | completeness
float64 76.3
100
⌀ | contamination
float64 0
4.4
⌀ | strain_heterogeneity
float64 0
100
⌀ | markers
float64 124
383
⌀ | 5s_rrna
stringclasses 2
values | 16s_rrna
stringclasses 1
value | 23s_rrna
stringclasses 1
value | trnas
float64 14
20
⌀ | draft_quality
stringclasses 2
values | start_position
int64 0
10M
| autotrain_text
stringlengths 150
150
| autotrain_label
class label 2
classes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
G000006845 | ASM684v1 | GCF_000006845.1 | PRJNA57611 | SAMN02604088 | null | 2005/02/14 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/845/GCF_000006845.1_ASM684v1 | 637,000,188 | RS_GCF_000006845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 242,231 | 485 | Neisseria gonorrhoeae FA 1090 | strain=FA 1090 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Neisseriaceae | Neisseria | Neisseria gonorrhoeae | true | Neisseria gonorrhoeae FA 1090 | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 2,153,922 | 1 | 52.69 | 2,153,922 | 1 | 2,142 | 609,210 | 83.31778 | 99.82 | 0.21 | 0 | 323 | yes | yes | yes | 20 | high | 390,390 | ACTGCGTGAAAAACTGGATGCCGTCCTTGCCTATTACAACGTCCAACTCCAATACCTGCATAACGCCGGACCGGTTAAAGCGGAAGACGTGATGGCGGTTATCGAAAAAGTCGCGCCGCGCATTGCGCCGATGATTGCCGACGTGTCCCG | 0no label
|
G000007225 | ASM722v1 | GCA_000007225.1 | PRJNA172 | SAMN02604075 | null | 2002/01/24 | UCLA/CalTech | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/007/225/GCA_000007225.1_ASM722v1 | 638,154,513 | GB_GCA_000007225.1 | Monoisolate | Complete Genome | Full | na | Major | 178,306 | 13,773 | Pyrobaculum aerophilum str. IM2 | strain=IM2 | null | Archaea | Crenarchaeota | Thermoprotei | Thermoproteales | Thermoproteaceae | Pyrobaculum | Pyrobaculum aerophilum | true | Pyrobaculum aerophilum str. IM2 | Archaea | Crenarchaeota | 1 | 1 | 0.8 | 0.6 | 2,222,430 | 1 | 51.36 | 2,222,430 | 1 | 2,631 | 675,358 | 89.497712 | 100 | 0.74 | 0 | 176 | no | yes | yes | 16 | medium | 281,190 | TAGCGACGCCAGCCTAGACAAGTGGGGCAGGTGGCCGACTATAAAGAGATCCTCTGTGAGGGCCTCCGCCTTGGCCGCCCATATTGCCGGGTCGTCGTTTGGATTCAGCCCCTCCTCGGCGCGGATCTCGGCGCCTATATGCCTCGCGAA | 0no label
|
G000007385 | ASM738v1 | GCF_000007385.1 | PRJNA224116 | SAMN02603680 | null | 2005/02/02 | NIAB, Rural Development Administration | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/385/GCF_000007385.1_ASM738v1 | 637,000,346 | GB_GCA_000007385.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 291,331 | 347 | Xanthomonas oryzae pv. oryzae KACC 10331 | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas oryzae | true | Xanthomonas oryzae pv. oryzae KACC 10331 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,941,439 | 1 | 63.69 | 4,941,439 | 1 | 4,831 | 1,427,680 | 85.113992 | 99.82 | 0 | 0 | 355 | yes | yes | yes | 20 | high | 1,641,900 | GTTGGCGCGGGCTGGCCGATGGCGTGCTGGAGCGCAGCGTCGCCGCGATGCGAACGCCACCGCAGCAGCTGATGGCCTGGCTGGGTCCGGCGGCGGGGCCGCAGGTGTATGAAATTGGCCAAGACGTCTTCGATGCCTTCGTTGCGCACG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,287,100 | AGGAGAGGGAGCCTGCCGCTGGCACCCACCCTACTGGACACTGGGGCCTGGCATCGCTTGCAGAGCTATTACCCTACCTGTTTTATCAGAACTGCAAAGAATTGTCTCCTTCTTCCTGCCGAATGGCCCATGTCTCATCCACACCGAGAT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,361,500 | ATTAAATTAAGATGCAAAGTTAAAAATTTTATATGGACTTACAGCCCCTTGATAATACTTCCACAGAGCCGCAGTTGAGAAACACTGCTCTCTTGGAAAGGGTGCAGAGCTGGTGTCAGAAGCAGATTCGAGTCTTGGCTCTGCCGCTAC | 11
|
G000010205 | ASM1020v1 | GCF_000010205.1 | PRJNA224116 | SAMD00060919 | null | 2008/05/29 | Kitasato Institute for Life Sciences | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/205/GCF_000010205.1_ASM1020v1 | 642,555,145 | RS_GCF_000010205.1 | Monoisolate | Complete Genome | Full | na | Major | 334,380 | 784 | Orientia tsutsugamushi str. Ikeda | strain=Ikeda | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rickettsiales | Rickettsiaceae | Orientia | Orientia tsutsugamushi | true | Orientia tsutsugamushi str. Ikeda | Eubacteria | Proteobacteria | 0.99 | 1 | 0.9 | 1 | 2,008,987 | 1 | 30.51 | 2,008,987 | 1 | 2,188 | 522,417 | 76.576503 | 99.51 | 0.49 | 0 | 186 | yes | yes | yes | 20 | high | 1,607,840 | CCTGTATATTTAACTACTTATACTGGCAAACCTCCAGATGAACCATCTGTTATTGGCGAAGCATTAAATGAAATTGTGATACCGTTAATTCAAAAACAATTTCCTGAAATTTTGGATTTTTGGCTTCCTCCTGAAGGATGTTCATACCGA | 0no label
|
G000006745 | ASM674v1 | GCF_000006745.1 | PRJNA57623 | SAMN02603969 | null | 2001/01/09 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/745/GCF_000006745.1_ASM674v1 | 637,000,333 | RS_GCF_000006745.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,277 | 666 | Vibrio cholerae O1 biovar El Tor str. N16961 | strain=N16961 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Vibrionales | Vibrionaceae | Vibrio | Vibrio cholerae | true | Vibrio cholerae O1 biovar El Tor str. N16961 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 4,033,464 | 2 | 47.49 | 2,961,149 | 1 | 3,594 | 1,184,587 | 86.533164 | 99.86 | 0.03 | 0 | 360 | yes | yes | yes | 20 | high | 557,050 | AACTTGAAGTGATTGAAGGGGCGGGACATATCAGTAGTTTGGAGCAGGCAGAATCGGTGACACACCACCTGCAAACGTTCTTAGCAACCGTATATTGATTTTTCTGCCATTGATGAAATGGCGATCACCTATTGAGCCGCGCACGGTTAC | 0no label
|
G000007085 | ASM708v1 | GCF_000007085.1 | PRJNA224116 | SAMN02603009 | null | 2002/05/14 | Beijing Center.HGP | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/085/GCF_000007085.1_ASM708v1 | 637,000,318 | RS_GCF_000007085.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 273,068 | 911,092 | Caldanaerobacter subterraneus subsp. tengcongensis MB4 | strain=MB4 | null | Bacteria | Firmicutes | Clostridia | Thermoanaerobacterales | Thermoanaerobacteraceae | Caldanaerobacter | Caldanaerobacter subterraneus | true | Caldanaerobacter subterraneus subsp. tengcongensis MB4 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,689,445 | 1 | 37.57 | 2,689,445 | 1 | 2,674 | 812,453 | 88.995016 | 99.04 | 0.6 | 0 | 329 | yes | yes | yes | 20 | high | 1,643,590 | TCTTTACTTTTCCGGATTTTAACACCTTAAATCTCTTTGCTGCTCCCCTATGAGTTTTCATCTTTATTTTTGCCATAATTATCCTCCTCTTCTACTGTTTTTTAGGTGCTATTACCATCATCATGTTGCGACCATCCATGCTCGGCGCCT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,390,150 | CCTGGGTTCAAGTGATTCTTGTGCCTCAGCCTCCAGAGTAGCTGGGATTACAGGCACCTGCCACCATGCCTGGCTAATTTTTGTATTTTTAATAGAGACAGGGTTTCACTATGTTGGCCAGCCTGGTCTCAAGCTCCTGACCTCAAGTGA | 11
|
G000008525 | ASM852v1 | GCF_000008525.1 | PRJNA57787 | SAMN02603995 | null | 1999/12/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/525/GCF_000008525.1_ASM852v1 | 637,000,132 | RS_GCF_000008525.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 85,962 | 210 | Helicobacter pylori 26695 | strain=26695 | null | Bacteria | Proteobacteria | Epsilonproteobacteria | Campylobacterales | Helicobacteraceae | Helicobacter | Helicobacter pylori | true | Helicobacter pylori 26695 ASM852v1 | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 1,667,867 | 1 | 38.87 | 1,667,867 | 1 | 1,579 | 514,109 | 90.817493 | 99.36 | 0 | 0 | 275 | yes | yes | yes | 20 | high | 1,306,630 | TTGGAGCATTATTTTTCCATCCTTAATGATGTGAGCGGTTTTAATAGCGCTGAAATGCTAGAAGTCGCAAAAGATTACAAGCCCACTTGCATTTTAATGCACACTCAAAAAACCCCCAAAGACATGCAAGAAAATGTTTTTTACCACAAT | 0no label
|
G000008565 | ASM856v1 | GCF_000008565.1 | PRJNA57665 | SAMN02603976 | null | 2000/12/11 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/565/GCF_000008565.1_ASM856v1 | 637,000,092 | RS_GCF_000008565.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,230 | 1,299 | Deinococcus radiodurans R1 | strain=R1 | null | Bacteria | Deinococcus-Thermus | Deinococci | Deinococcales | Deinococcaceae | Deinococcus | Deinococcus radiodurans | true | Deinococcus radiodurans R1 ASM856v1 | Eubacteria | Terrabacteria | 1 | 0.991 | 0.8 | 1 | 3,284,156 | 4 | 66.61 | 2,648,638 | 1 | 3,248 | 987,980 | 88.625967 | 98.72 | 0 | 0 | 359 | yes | yes | yes | 20 | high | 458,770 | AACTCCTCCAGCACCTTCGCCAGCGGCACTTTCGCCGTGCGGACGCGCAGTTTTTCGCCGGTCAGGACGTTGGTGTAGCTGCCCGTCGGCAGGGTCAGCGTGCGGTTGCCCCAGCGTTCAGCCAGCGCCCAGGGGCTCTGCTCGCGGGTG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,453,400 | TACGTCTCTCCAATTATTTAGGTCTTCTTTGATTTCACCTAAGAATAACCACAATGACAACTAGCAAAAGGACAGTTTTATTGTTTTCAGCATACAGATCCCCTAACTATTTTGTTAGATTTAGTTCATGGAGGGCAGGCTTTGTAAACA | 11
|
G000006725 | ASM672v1 | GCF_000006725.1 | PRJNA224116 | SAMN02603773 | null | 2004/06/04 | Sao Paulo state (Brazil) Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/725/GCF_000006725.1_ASM672v1 | 637,000,348 | RS_GCF_000006725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 160,492 | 2,371 | Xylella fastidiosa 9a5c | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xylella | Xylella fastidiosa | true | Xylella fastidiosa 9a5c | Eubacteria | Proteobacteria | 0.98 | 0.993 | 0.9 | 1 | 2,731,750 | 3 | 52.62 | 2,679,306 | 1 | 2,664 | 765,931 | 82.59299 | 99.59 | 0.18 | 0 | 325 | yes | yes | yes | 20 | high | 2,487,550 | GAAGGTGCCTACGAACGTAACGTACGCCTCCCCTCCGGCGGCTCCATTGTGGTTGATCAAACAGAAGCGCTCACTGCCATTGATGTCAACTCTTCACGAGCTACAAAGGGTAACGACATTGAGGAAACCGCATTCCAAACCAACCTGGAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,324,500 | AACGATTCTATCATTTAACCTAGGAACACAACTTTTTGAAATTTATCCAAAGAAAGAGCTTAAAGAAAAAAAGAAAATTATATATCGTATAGCTAAGAAGCTGAAAATAGTCTGAATTCCCAACTTTTTAGAAAGGTCCAGACTATTACA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,869,600 | TTCCACATGGCTGGGGAGGACTCACAATCATGGCGGAAGGCAAAGGAGGTGCAAAGGCACATCTTACATGGTGGCAGGCAAGAGGGCATGTGCAGGGGAACTCCCATTTATAAAACCATCAGATCTCATGGGACTTATTCACTATCATGA | 11
|
G000009825 | ASM982v1 | GCF_000009825.1 | PRJNA224116 | SAMD00061074 | null | 2004/12/30 | Kao Corporation, Biological Science Laboratories, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/825/GCF_000009825.1_ASM982v1 | 637,000,019 | RS_GCF_000009825.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 66,692 | 79,880 | Bacillus clausii KSM-K16 | strain=KSM-K16 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus clausii | true | Bacillus clausii KSM-K16 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 4,303,871 | 1 | 44.75 | 4,303,871 | 1 | 4,304 | 1,270,194 | 86.940919 | 98.67 | 0.33 | 0 | 373 | yes | yes | yes | 20 | high | 2,427,750 | TTCTTCATTGCCGATAAGGGTGACCTCAAGCTCTGGAAATGTCTGAACCGCCCGAATCGCCGCTTCGACGTGTGCTTTAGGCGCATTGTCTCCCCCCATGGCATCCAAAGCTATTCTCATTGCTGTGGCCTCTCTTCCGTTTCGTTTTGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,498,150 | CTTAAAATACAAAAAATTAGCTGGGCGTGGTGGTATGCACCTGTAATCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGGAGGCGGAGGTTGCAGTGAGCTGGGATCGCGCCATTGCACTCCAGCCTGGGGACAAGA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,411,650 | CTCTCCGCCAGTCTGGAGTGCAGCGGCATGATTTCAGCTCACTGCAAACTCCACCTCCCGGGTTCAAGCAATTCTCCCGCCTCAGCCTCTTGAATAGCTGGGATTACAGGCATGCACCACCACGCCCAGCTAGTTTTTGTATTTTTAGTA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 805,650 | GCCGCAGCGCCCGGCGCCCTCAGGCCTCCCGCTGACCCTTCCCAAGCCCGACCTCGACGCGGCTCAAATTGACCGTTCTGCGGCCGCCCTCGGGCACTTCCGGTCCGTCCCCAAGTCGGCCCCGATCGGCAGCGGCCACCCGGCGGTTCC | 11
|
G000009125 | ASM912v1 | GCF_000009125.1 | PRJNA224116 | SAMEA3138192 | null | 2003/05/06 | Genoscope | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/125/GCF_000009125.1_ASM912v1 | 637,000,231 | RS_GCF_000009125.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 267,608 | 305 | Ralstonia solanacearum GMI1000 | strain=GMI1000 | null | Bacteria | Proteobacteria | Betaproteobacteria | Burkholderiales | Burkholderiaceae | Ralstonia | Ralstonia solanacearum | true | Ralstonia solanacearum GMI1000 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 5,810,922 | 2 | 66.98 | 3,716,413 | 1 | 5,062 | 1,725,241 | 87.482692 | 99.94 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 773,110 | CGTCAATGGCTGACGAGGCCGCCCAGTTCATGAAGTTGCCCGAGAACTTTCCGGAGCATTCGTGTGTGTCCGACGTGGCGTCACCGGAAATGGCGAACCAGCCGTTTGTGTCGTCGTAGGTGTAGCACTTGGTCGCGTTGAAGTAGCCCA | 0no label
|
G000007925 | ASM792v1 | GCF_000007925.1 | PRJNA57995 | SAMN02603142 | null | 2003/07/25 | CNRS | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/925/GCF_000007925.1_ASM792v1 | 637,000,213 | RS_GCF_000007925.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 167,539 | 1,219 | Prochlorococcus marinus subsp. marinus str. CCMP1375 | strain=CCMP1375; SS120 | null | Bacteria | Cyanobacteria | null | Synechococcales | Prochloraceae | Prochlorococcus | Prochlorococcus marinus | true | Prochlorococcus marinus subsp. marinus str. CCMP1375 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 1,751,080 | 1 | 36.44 | 1,751,080 | 1 | 1,908 | 529,797 | 89.120257 | 100 | 0 | 0 | 312 | yes | yes | yes | 20 | high | 1,654,770 | TTAGGATCAAATAAATCTTTTACCTTTAATAACTCCTCAGATTTAGCAAAACCTTCATCAGTAAGAGTACATGTTCTTTGCTTTTCATCTACTTCATAATCTCCTTCAGGATCAATTCCATCTTTTCCCATCTCAGCAGCTCTTTGCAAA | 0no label
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Nostoc sp. PCC 7120 ASM970v1 | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 1,276,600 | ATCAACTGGTAATAAAGGCAATTCATCCCGTAGTTCTTGTAAAGCTTGATATGCTGATTGCCAGTCTTTTTCCCAATTTCCAGTAAAAGGAAACTGACGAAAACTGCTGCGTTGGTCTGTCATCAGAGTTAATTCAATCCAACCATCAGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 257,100 | TACCTTTGGGACAGGCGTGGATGACATCCCATAATTTACTTCGTTATTAATTTCTAAATGTAATACATACCACTCTCTAAAAGTATTTTTTAATTTGAAATATATTTGTATATATGTACATATATATTTATTTATTTCTGAATTTTGTCT | 11
|
G000008765 | ASM876v1 | GCF_000008765.1 | PRJNA57677 | SAMN02603243 | null | 2002/11/22 | Genome Therapeutics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/765/GCF_000008765.1_ASM876v1 | 637,000,076 | RS_GCF_000008765.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,562 | 1,488 | Clostridium acetobutylicum ATCC 824 | strain=ATCC 824 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium acetobutylicum | true | Clostridium acetobutylicum ATCC 824 | Eubacteria | Firmicutes | 1 | 0.998 | 0.1 | 0.9 | 4,132,880 | 2 | 30.93 | 3,940,880 | 1 | 3,896 | 1,211,240 | 86.343567 | 100 | 0 | 0 | 345 | yes | yes | yes | 19 | high | 325,130 | AAAGATAAAATGTGGCCATTACCTGTTGGTGAGCTATTTATGGTTGGGAAAAGTATGAAGAGGAAGTTAAATGAACTACACATTAAAACCATTGGTGAACTTGCAAAATATGATGTTAATATTCTTAAAGCCAAGTTTAAAAGTCATGGA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,755,700 | AATACAGATGTTATGAACATTTATGCCAAATCAACTCCTTTTGTGGTCATAGACTTTTATTTCTCTTGGGTAAATATCTAGGAGTGAAATATTTGGGTTGTATTGTAAGTATATAGTCATTTCTTAAAAAACTTGCCCAGCAATACTGCA | 11
|
G000009185 | ASM918v1 | GCF_000009185.1 | PRJNA224116 | SAMEA3138195 | null | 2006/06/22 | Max Planck Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/185/GCF_000009185.1_ASM918v1 | 637,000,129 | RS_GCF_000009185.1 | Monoisolate | Complete Genome | Full | na | Major | 362,976 | 293,091 | Haloquadratum walsbyi DSM 16790 | strain=DSM 16790 = HBSQ001 | null | Archaea | Euryarchaeota | Halobacteria | Haloferacales | Haloferacaceae | Haloquadratum | Haloquadratum walsbyi | true | Haloquadratum walsbyi DSM 16790 DSM 16790 = HBSQ001 | Archaea | Euryarchaeota | 1 | 0.997 | 0.9 | 1 | 3,179,361 | 2 | 47.86 | 3,132,494 | 1 | 3,071 | 845,315 | 78.317152 | 99.3 | 0 | 0 | 220 | no | yes | yes | 19 | medium | 2,902,770 | CGATAACATCCGCTCCTGCTTCAGATGCTTGAAGATATCCAATGTTCCGCCGCTGAATAGAATTATACGGCAGGTATTCATCAAGCCTCTCAAGACCTCGTGATTCCATCCAGTCTATCTGGTCTTGAACGCCAACATATCTCACCGTGG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,864,300 | TCATGGAGAGTTGACCCGAGGGCAGTGGTCCAGGCAGTACCTCCTTTCCTGGGGTGAGCTCACCATTCTGCAGGGACACAGGTGAGACCACCTGGAAAGGCAGGGCCAAGTAGGGCTCTGAGGACCCCTCCCTCCAACCTGCATCTCCAG | 11
|
G000011065 | ASM1106v1 | GCF_000011065.1 | PRJNA62913 | SAMN02604314 | null | 2003/03/28 | Washington University Department of Molecular Biology and Pharmacology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/011/065/GCF_000011065.1_ASM1106v1 | 637,000,026 | RS_GCF_000011065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,186 | 818 | Bacteroides thetaiotaomicron VPI-5482 | strain=VPI-5482 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Bacteroidaceae | Bacteroides | Bacteroides thetaiotaomicron | true | Bacteroides thetaiotaomicron VPI-5482 | Eubacteria | Bacteroidetes | 1 | 0.998 | 0.7 | 1 | 6,293,399 | 2 | 42.86 | 6,260,361 | 1 | 4,944 | 1,919,297 | 89.876027 | 99.41 | 0.4 | 0 | 348 | yes | yes | yes | 20 | high | 2,900,560 | AGCAAAAAGCAGGGACAGTCGCAACAGGCGGCCGTCCGTCAGGAGGGCACGAAGCCGGAAAACACCGTCAGCCGGAACCGCCCGGTACAGAAAACCGATAAGAAAGGAGTATCCATTTAACCATTCACATAAATAATACATTATATATGA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,121,900 | GAAGTGACACCACCACATCTCCTTTGTTCTAAGACACTCATTCTCGTTTCTCCGTTTAGCTTGTCTGGAACTGGGACATATTTTATAATTATGATGAATGCTAAATATAATGGGGTTTCACTTGCTCTCCCTGGGTGCTGTTGTTAAGTC | 11
|
G000005825 | ASM582v2 | GCF_000005825.2 | PRJNA224116 | SAMN02603086 | null | 2010/12/15 | Center for Genomic Sciences, Allegheny-Singer Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/005/825/GCF_000005825.2_ASM582v2 | 646,311,908 | RS_GCF_000005825.2 | Monoisolate | Complete Genome | Full | representative genome | Major | 398,511 | 79,885 | Bacillus pseudofirmus OF4 | strain=OF4 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus pseudofirmus | true | Bacillus pseudofirmus OF4 | Eubacteria | Firmicutes | 1 | 0.995 | 1 | 1 | 4,249,248 | 3 | 39.86 | 3,858,997 | 1 | 4,260 | 1,228,222 | 85.144124 | 98.68 | 1.32 | 0 | 377 | yes | yes | yes | 20 | high | 64,610 | GGAAGCAAACATCAAGTCATGATCCATGATGTACAAATCGATCCGCTTAAAAATGAGTATGTACACGTTGATTTCTTTGAAGTCGATATGAAATCAGAGATTGATGCTGATGTACCTGTACGCTTAACAGGTGAAGCGCCGGGAACAAAA | 0no label
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Sinorhizobium meliloti 1021 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 3,533,140 | TATGAGAGCTTCATCACCGAATGGGGGCCGGGCGCCAAGGTGGCGGAAGCGTTCGAGAAGACCTGTGACTGCAAGGTCGACTATGTAGGGGTCGCCGACGGGGTCGAACTCCTGACGCGGCTGAAGCTCGAAGGTCAGGGATCGAAGGCC | 0no label
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 5,761,990 | ACGCCGATGTTGACGAAGTCGGCCTTCGCGCCGGAGGCGTTGATGACGACGTTCTTACGGGTCTCGACGACGAACGGGATGCGCTCGACGACCTGGGTGCGCGGGTCGTCCTCGCCGAAGTAGGAGACCTGGAACTTCTCCTTGTACGGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,640,200 | TCTTTCTCTGACCTCCTCTCCTGAGTCCCCCTTCTACTTCTAATGACCTTGTGATTACATTGAGCCCAGCTGGGTAATCTGAAATCATCTCCCCATCTCAAGATCAGCTGATTAGCAGTCTTAATTCAACTTGCCAACTTACTTCCCCTT | 11
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Sinorhizobium meliloti 1021 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 586,690 | CGCTCTAATGCTCGGGCCGGCTGCTCTTCCATCGCCTTGCGCGCCACCACGCGGTCATAGGCGGCTTGCAGCGTTTGCCGCACGGACGGGCCTTCCGGCATGGGATCGCCGAGGTGTTCGGCGCGCAATTCGCGCATGAAACGCTCCCAG | 0no label
|
G000008525 | ASM852v1 | GCF_000008525.1 | PRJNA57787 | SAMN02603995 | null | 1999/12/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/525/GCF_000008525.1_ASM852v1 | 637,000,132 | RS_GCF_000008525.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 85,962 | 210 | Helicobacter pylori 26695 | strain=26695 | null | Bacteria | Proteobacteria | Epsilonproteobacteria | Campylobacterales | Helicobacteraceae | Helicobacter | Helicobacter pylori | true | Helicobacter pylori 26695 ASM852v1 | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 1,667,867 | 1 | 38.87 | 1,667,867 | 1 | 1,579 | 514,109 | 90.817493 | 99.36 | 0 | 0 | 275 | yes | yes | yes | 20 | high | 689,390 | ATTGTTTATGCGCATTTGCCCATTATTTTAGATGAAGTAAGCGGTAAAAAGATGAGTAAAAGAGATGAAGCCTCCAGCGTGAAATGGCTTTTGAATCAAGGGTTTTTACCGGTTGCGATTGCGAATTACCTCATCACTATCGGTAATAAA | 0no label
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 6,678,100 | CGCGAGGAGATCAACGCCGCCCTGCGCGGAGTCCTCGACGAAGCGACCGGCAAGTGGGGCATCCGCGTCAACCGCGTCGAGCTCAAGGCCATCGAGCCGCCGACCTCCATCCAGGACTCGATGGAGAAGCAGATGCGCGCCGACCGCGAC | 0no label
|
G000007825 | ASM782v1 | GCF_000007825.1 | PRJNA57975 | SAMN02603340 | null | 2004/07/06 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/825/GCF_000007825.1_ASM782v1 | 637,000,017 | RS_GCF_000007825.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,900 | 1,396 | Bacillus cereus ATCC 14579 | strain=ATCC 14579 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus cereus | true | Bacillus cereus ATCC 14579 | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,427,083 | 2 | 35.29 | 5,411,809 | 1 | 5,541 | 1,546,426 | 83.933929 | 98.18 | 0.58 | 18.18 | 383 | yes | yes | yes | 20 | high | 3,790,670 | ACAGTGCAAAATGTACTTTAAAGTATGCGATACGTACAGCCATAAGTACGTAAGCAGCCGCATGGGCTTTAGGGAACATGTATTTAATCTTCTTACATGAATCAATATACCAACCTGGCACATTATTATTTTTCATGTCTTCTTCCCATT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,198,800 | CAGCCCAGCAGAGGGAGCGGCCAGCCTTGCTTTCCCAGAAGCCCTCAATGCTTCCAGTTACCCACAACCAAAAGCTGCTGAAATTCAGCTTGATTTGGAAAATGCGCATAAGCCACCCAGCTAGGCCCTTTGGGGCCCCACCTGGCCACA | 11
|
G000007005 | ASM700v1 | GCF_000007005.1 | PRJNA224116 | SAMN02603227 | null | 2002/11/25 | European/Canadian Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/005/GCF_000007005.1_ASM700v1 | 638,154,518 | RS_GCF_000007005.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 273,057 | 2,287 | Sulfolobus solfataricus P2 | strain=P2 | null | Archaea | Crenarchaeota | Thermoprotei | Sulfolobales | Sulfolobaceae | Sulfolobus | Sulfolobus solfataricus | true | Sulfolobus solfataricus P2 | Archaea | Crenarchaeota | 0.96 | 1 | 1 | 0.9 | 2,992,245 | 1 | 35.79 | 2,992,245 | 1 | 3,281 | 874,971 | 86.125133 | 100 | 0 | 0 | 196 | no | yes | yes | 14 | medium | 803,270 | ATACACGTATTTTATTTTGCATTCTTTGCATTTTCAATGTTTTTAGTCTATCTTTAGCCCTACCGTACCCTATTATAGTATGAAATCCCCAGTCATGTACTTTTGGAGTGCTTGGACTACCTACTCTTTCTTTTTCATTTCTGTCTTTTG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,898,500 | CACATCTCCACTTTGTGTATTTGTGCTTTGAGAAGTATGTACATTAGGATACTTTTGAATGTGTATTAGTCTGTTCTCACACTGCTATAAAGAAATACCTGAGATGGGGCAATTTATAAAGAAAAGAGGTTTAGTTGGCTCACCATTCCA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,173,150 | TTCTTCCTCTGAGACCCCTTCCAGGAATTCAAAGGGGCTGGTGAGTCATGAGGCCTCGGAGCAGGGAGTGGTGGTGGTTACATAATTCAGATTAACTCTCAGTTAATCTGCCTTGAATAGAGAGTCAGGCTGGAGGGTGTCCATGTCAGA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,648,450 | ATGGGAGTGGGTTAGTGATCATGGGAGTGGATTAATGATCATGGGAGTGGGTTAGTTGTCATGGGAGTGGGTTGGTTATCATGAGAGTGGGTTAGTTATCATGAGAGTGAGTTAGTGATCACGAGAGTGGGTTAGTTATTGTGAGAGTGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,914,750 | GCGCCTGCTACGTGTTGGATCATGGCCTCACAGGGACAGAGCAGGGAGGAGGACTTCGAGGTCCCTGCCCCAGGGATGTCCCGGGGTCAGGCAGTGCTCTGAGGACTGGGGAGCCCCACTGTGCTGTGCAGGGACCTGGGGGAGCAGCAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,456,750 | GATTCAAGCAATTCTCCTGCCTCAGTCTCTGGAGCAGCTAGGGCTACAGGCGTGTGCCACCATCCCCCAGTTAATTTTTTTTTTTTTTGAGACAAAGTCTTCCTCTGTCACCCAGGCTAGAGTGCAGTGGCATGATCTCAGCTCACTGCA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,377,550 | TACAAAAATTAGCCAGATGTGGTGACGCATGCCTGTAATCCCAGCTACTTGGCAGGCTGAGGCACGAGAATCACTTGAACCTGGGAGGTGGAGGTTGCAATGAGCCGAGATCATGCAACTGCAATCCAACCTGGGCGACAGAGCAAGACT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,584,350 | AGAATTGATCCTTAAAATGAAAGACAGAAGGTTAGAAAATATAAAATCTTTAGCCAATAAAGACAAAAAGGGAAGTTGGGTAATAGTCTTAATACCTGACAAAATATGATTTGAGATAAAAATGTCATAAAACACAGAGGTGTTATATGC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,209,300 | CTTCTCCTGGAAGCCCTCAAATACCCTCAACTCCAGCTTCTTGGCTGATTTTAATTCCACCTCTGGCCTGTACGGCGTCTGTGGCAAGCCCAGGATCACGACTGTGGCAGAGGGTAGAGTGTCAGGGACCCCAGTGGGCTTCAAGGGAGC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,743,500 | AGAAAAGAAAGAAAAGTTAGAGCCGAGCTGGGCATGATGGCTCACATCTATAATCACAGAACTTTGGGAGGATTGCTGGAGTCCAGGAGTCCCAGCCTGGGCAACATAGTGAGACCCCATCTCTACAAAAAATAAAACAAATTAGCCGGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,168,850 | CCACACCCCCAGGTGAGCATCTGATGGTCTGGAGCAGCACCCACACCCACAGGTGAGCATCTGACAGCCTGCAACAGCACCCACACCCCCAGGTGAGCATCTGACAGCCTGGAAGAGGACCCTGCAGCCCCAAGTGAGCACCTGACAACC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,974,900 | AGTAGAATGGAAATAAAAATTAAAGGGGGAAAAGGATAAGATGCAACATTGGACTGCTTTTAAAAAATGAACTTGTCGGGCATGGTGGCTCACACCTGTAATCCCATCACTTTGGGAGGCTTAGGTGGGCAGATTACCTGAGGTCAGGAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,710,850 | TAAAAACCATCTATGATAAAGCCACAGCCAACATTATACTGAATAGGGAAAAGTTGAAAGCATTCCCCTGAGAACTGGAAAAAGACAAAGATGCCCACTCTCACACTTCTATTCAACATAGTACACAAGTTCTAGCCAGAACAATCAGGC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,759,000 | CACGATATTGATTCTTCCTACCCATGAGCATGGAATGTTCTTCCATTTCTTTGTATCCTCTTTTATTTCATTGAGCAGTGGTTTGTAGTTCTCCTTGAAAAGGTCCTTCACATCCCTTGTAAGTTGGATTCCTAGGTATTTTATTCTCTT | 11
|
G000010085 | ASM1008v1 | GCF_000010085.1 | PRJNA224116 | SAMD00061079 | null | 2006/01/10 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/085/GCF_000010085.1_ASM1008v1 | 637,000,270 | RS_GCF_000010085.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 343,509 | 63,612 | Sodalis glossinidius str. 'morsitans' | strain=morsitans | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Pectobacteriaceae | Sodalis | Sodalis glossinidius | true | Sodalis glossinidius str. 'morsitans' morsitans | Eubacteria | Proteobacteria | 1 | 0.993 | 1 | 1 | 4,292,502 | 4 | 54.5 | 4,171,146 | 1 | 5,742 | 1,142,020 | 78.310831 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 2,257,580 | GAGAACACATTTTGTCAGCCCAGAATGTACTACAACGCGAAAACCGGGCTTTTTTATGATGTTCCGGAATTCACAACAATCAATAAGCGTCAACATAATAAATCACTATAAGCTATCTTTTGGATCTTATTGAATCTCTAATTTTAGATA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,023,600 | TTTCTATTTGTTCAGAGGGGGAAAAATCTGCTTGCTATTCAGGCCCTAGATTTTCCTGAGAGATTAGTGTACTTGCCTGCCAAGATGTTAGCTAAAGGAAAACACATTTGCTATAGATCAGAAATATTTATCCTTTTCTGGGCAGGAGAT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,261,850 | GCCTCAGCTGTTATAGTAACTATAGAAGTAGGGTTATTTTCTTGTTTGTTTCAATCTAGAGTCATAAGAGACCATCAAAAAAAAAAAAACCCTATTGAAACCATGTTTAGAGCGAAAAAGTCTATATTCTTTTTAGGGGATTAGTAGTCA | 11
|
G000010565 | ASM1056v1 | GCA_000010565.1 | PRJDA19023 | SAMD00060921 | null | 2007/05/07 | Marine Biotechnology Institute Co., Ltd | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/010/565/GCA_000010565.1_ASM1056v1 | 640,427,128 | GB_GCA_000010565.1 | Monoisolate | Complete Genome | Full | na | Major | 370,438 | 110,500 | Pelotomaculum thermopropionicum SI | strain=SI | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptococcaceae | Pelotomaculum | Pelotomaculum thermopropionicum | true | Pelotomaculum thermopropionicum SI | Eubacteria | Firmicutes | 0.98 | 1 | 1 | 1 | 3,025,375 | 1 | 52.96 | 3,025,375 | 1 | 3,001 | 887,464 | 86.415667 | 100 | 0.63 | 0 | 331 | yes | yes | yes | 20 | high | 32,890 | AACAAAAAGATATCAGCTCGGCCACAACATACTGAGGCTGGCCAGAATGGTCGAGCAGAGCTTGAAAAGTATTGCCGTGCAGGTTATGAAGGAACTGGCCGCAAAGACCGGGGAGTCGGTTTATTTAAGCATGTCAAAAAACTGCCAGTA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,580,350 | GGATTACAGGCATGAGCCACTGTGCCCGGTAGTCTTGTGCTTTTAAGTAGAGTACTTTAACTTCACTGTTGTTTGTTATTTATATAGTGTATTACAGTGAGTTCATTGCCCTATAGTTCACTGCCTATAGGTTCATTGCAGAACCATGAC | 11
|
G000010185 | ASM1018v1 | GCF_000010185.1 | PRJNA224116 | SAMD00060918 | null | 2008/02/14 | Kitasato Institute for Life Sciences | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/185/GCF_000010185.1_ASM1018v1 | 641,522,627 | RS_GCF_000010185.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 334,413 | 1,260 | Finegoldia magna ATCC 29328 | strain=ATCC 29328 | null | Bacteria | Firmicutes | Tissierellia | Tissierellales | Peptoniphilaceae | Finegoldia | Finegoldia magna | true | Finegoldia magna ATCC 29328 | Eubacteria | Firmicutes | 1 | 0.995 | 1 | 1 | 1,986,740 | 2 | 32.07 | 1,797,577 | 1 | 1,846 | 611,719 | 90.720879 | 99.39 | 0 | 0 | 282 | yes | yes | yes | 20 | high | 1,555,060 | CAAAAGGCCATTGACGGGCTTTTTGAAGATGACTATGAAAAATTAGATGAAAGTGGAGAATTAAGAGACCTCGCCCTTTCAATTAACAAGGCAAACGAAAAATATAATAACTTAAAAAAATCACAAAGTAAGTGGATAAGGGGAGTTAGC | 0no label
|
G000008865 | ASM886v1 | GCF_000008865.1 | PRJNA57781 | SAMN01911278 | null | 2004/05/11 | GIRC | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/865/GCF_000008865.1_ASM886v1 | 637,000,108 | RS_GCF_000008865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 386,585 | 562 | Escherichia coli O157:H7 str. Sakai | strain=Sakai substr. RIMD 0509952 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Enterobacteriaceae | Escherichia | Escherichia coli | true | Escherichia coli O157:H7 str. Sakai Sakai substr. RIMD 0509952 | Eubacteria | Proteobacteria | 1 | 0.996 | 0.9 | 1 | 5,594,477 | 3 | 50.48 | 5,498,450 | 1 | 5,399 | 1,663,868 | 87.620737 | 99.97 | 0.33 | 0 | 374 | yes | yes | yes | 20 | high | 2,041,390 | CCCAGTTGATGAAGTACATCCAGCCAGCAACATAAGCGGCTTTCTCACCCAAAAACTCACGGGCATAAGAGACAAAACTGCCACTGGAAGGGCGGTGTAGCACCAGCTCACCCAATGCACGCAGAATAAAAAACGAAAACAAGCCACAAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,817,600 | AGGGCGGCACTTACCAGAAGCCTGTGTGCTGACCGGCCTGGTCTCCTTTGACGTCTCGAGCAGCTTGGCAGGGTGGGAAAAGTAGCCTGAGAGTGATCCCCGGGCAGTGTCCGAGGCTCTGCCGTCCCCACCCCCACAGGCATCCAGGGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,109,100 | AGTGCCACATCTTAGCACCAGCGGCTGCGTTTGCTCCTTCGGTGCCTTCACGTGTGTGCGATGGTGACTCCCCAGGCAGGGATTCCAGACAGAGATTCCAGTCAGAGATTCCAGGATTTCCATAAACCCCAGCCACCTGTGTGCTGCAGG | 11
|
G000010645 | ASM1064v1 | GCF_000010645.1 | PRJNA224116 | SAMD00060940 | null | 2008/11/12 | RIKEN Genomic Sciences Center (GSC) | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/645/GCF_000010645.1_ASM1064v1 | 643,348,524 | RS_GCF_000010645.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 511,995 | 511,435 | Candidatus Azobacteroides pseudotrichonymphae genomovar. CFP2 | null | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | null | Candidatus Azobacteroides | Candidatus Azobacteroides pseudotrichonymphae | true | Candidatus Azobacteroides pseudotrichonymphae genomovar. CFP2 | Eubacteria | Bacteroidetes | 1 | 0.968 | 1 | 1 | 1,224,919 | 5 | 32.95 | 1,114,206 | 1 | 1,089 | 310,957 | 74.780128 | 89.51 | 1.09 | 0 | 252 | yes | yes | yes | 20 | medium | 1,176,760 | TACCCATTCTGACTTATTATAAAACTCTCTTCCATTTGTCATCTTAATAGTTAGCTCATTATCCCAAAACCAAGCTCTATCTATCGTTGTCTCTAGTGCAGGAGGCGCAGGATGGATCATATAGATCTTCGTCCCATTGGCTAAGTGAAA | 0no label
|
G000008685 | ASM868v2 | GCF_000008685.2 | PRJNA57581 | SAMN02603966 | null | 2011/11/09 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/685/GCF_000008685.2_ASM868v2 | 637,000,036 | RS_GCF_000008685.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 224,326 | 139 | Borrelia burgdorferi B31 | strain=B31 | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Borreliaceae | Borreliella | Borreliella burgdorferi | true | Borrelia burgdorferi B31 | Eubacteria | Spirochaetes | 1 | 0.879 | 1 | 0.9 | 1,521,208 | 22 | 28.18 | 910,724 | 1 | 1,511 | 441,681 | 85.52361 | 100 | 0 | 0 | 178 | yes | yes | yes | 20 | high | 415,350 | AAAGGCCTTGTTCTCTTTTCCCAACGAACAACATTTGCCCATTGATTAATTTTAAGAGGAAGATCTCTGTAAGACTTAATCCACTTACTATACATATTCCAAATAATTGTCTCAGAGGTAGGCCTTAAAACCAAAGGCTCTGCCAAACTC | 0no label
|
G000010305 | ASM1030v1 | GCF_000010305.1 | PRJNA224116 | SAMD00060909 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/305/GCF_000010305.1_ASM1030v1 | 643,692,024 | RS_GCF_000010305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 379,066 | 173,480 | Gemmatimonas aurantiaca T-27 | strain=T-27 | null | Bacteria | Gemmatimonadetes | Gemmatimonadetes | Gemmatimonadales | Gemmatimonadaceae | Gemmatimonas | Gemmatimonas aurantiaca | true | Gemmatimonas aurantiaca T-27 | Eubacteria | FCB | 1 | 1 | 1 | 1 | 4,636,964 | 1 | 64.27 | 4,636,964 | 1 | 4,004 | 1,466,180 | 93.177023 | 98.9 | 4.4 | 0 | 353 | yes | yes | yes | 20 | high | 22,230 | CCGGTGTGCCGGTGTTGCCGTTGCAGTTGGTCATGCACAATGCGGGCGCGGTGAAGGTGCCCGATCGGTATGGTCGCGAAGGCACACACTTTGTCACGTTGGCGCAGCAGGGGTGGCAGCAGATCATTTGGGAGATCGAGCCCCTCGCGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,503,350 | CTGTGTGCCCCAGCTCCTTCCTCTGACACCGAGGGGTCCTGTGGTCTGCAGCCATGTGGCCGGGGACCCTCTGTTAGTGAATCTGGGCTCTTGGCTGTGGTGCATGAGGAAAAGCAAACCCTCACCTGGCACAGGCACCGATCCCAGTCC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,207,350 | GCTGAGGTTCCCAGCCAGGGTGGAAAACACAGAGGAAAAACCCATGGGTCCCCTTGGACAGTGACTCCCGAAGGCCTTCCCTGGGGACAATGGCAAGATGGCTGCTGCCTTAACACATCCACCCAGGATGGACAGCGGCCACCGGTCAAT | 11
|
G000010305 | ASM1030v1 | GCF_000010305.1 | PRJNA224116 | SAMD00060909 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/305/GCF_000010305.1_ASM1030v1 | 643,692,024 | RS_GCF_000010305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 379,066 | 173,480 | Gemmatimonas aurantiaca T-27 | strain=T-27 | null | Bacteria | Gemmatimonadetes | Gemmatimonadetes | Gemmatimonadales | Gemmatimonadaceae | Gemmatimonas | Gemmatimonas aurantiaca | true | Gemmatimonas aurantiaca T-27 | Eubacteria | FCB | 1 | 1 | 1 | 1 | 4,636,964 | 1 | 64.27 | 4,636,964 | 1 | 4,004 | 1,466,180 | 93.177023 | 98.9 | 4.4 | 0 | 353 | yes | yes | yes | 20 | high | 1,443,260 | GTCGCGCCCCAAAAACGCCTGGGGCACCATCGATGTATTCGAGAGCTACAACCTCAAGGCGCCGGCCATCGCACTCTCGTGCGAAGACTACGGTCTCGTGTTCCGTCTGGCCGAGAACAAGCAGTCGCCCACGGTGCGTCTCAATCTCGA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,093,150 | CGCAGCCACCAGACAACCCGCAGCCACCAGACAACCCACAGCCACCAGACAACCCACAGCCACCAGACAACGCACAGCCACCAGACAACCCACAGCCACCAGACAACGCGCAGCCACCAGACAACGCGCAGCCACCAGACAACCCACAGC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,040,150 | GCCAAACACCAGTATCCACCACCCAGAATTAACTATTGTTCACTGTAGGTCATTATGTTTCTTTGGTTTGTAATAAAGAAACATAATATTTACCCACAAAAAAACGTTTTCAAGAAAAATGGGGCTAAGACCCCAGGACTGCACTCTTCT | 11
|
G000008685 | ASM868v2 | GCF_000008685.2 | PRJNA57581 | SAMN02603966 | null | 2011/11/09 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/685/GCF_000008685.2_ASM868v2 | 637,000,036 | RS_GCF_000008685.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 224,326 | 139 | Borrelia burgdorferi B31 | strain=B31 | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Borreliaceae | Borreliella | Borreliella burgdorferi | true | Borrelia burgdorferi B31 | Eubacteria | Spirochaetes | 1 | 0.879 | 1 | 0.9 | 1,521,208 | 22 | 28.18 | 910,724 | 1 | 1,511 | 441,681 | 85.52361 | 100 | 0 | 0 | 178 | yes | yes | yes | 20 | high | 824,850 | TTCCTAGTGTCAATAGAAACATTATAAGGCCCTTGCTTGAGGTTTCAAGACTAGAAATTGAAAATTTTTTATCTTTGAATAATATTGGGTTTTTTGTTGATAGTACAAATGCTCAAAATTTATATCTAAGAAATAGGGTTAGAAATAATT | 0no label
|
G000010585 | ASM1058v1 | GCF_000010585.1 | PRJNA224116 | SAMD00060930 | null | 2009/01/28 | Juntendo University School of Medicine | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/585/GCF_000010585.1_ASM1058v1 | 643,348,562 | RS_GCF_000010585.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 458,233 | 69,966 | Macrococcus caseolyticus JCSC5402 | strain=JCSC5402 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Macrococcus | Macrococcus caseolyticus | true | Macrococcus caseolyticus JCSC5402 | Eubacteria | Firmicutes | 1 | 0.965 | 1 | 1 | 2,219,737 | 9 | 36.56 | 2,102,324 | 1 | 2,352 | 677,409 | 89.896055 | 96.13 | 1.1 | 0 | 339 | yes | yes | yes | 20 | high | 2,219,490 | TATATGAATTTTTAGCTTTTAATGAAACTGATTATAGTGAATATTGGGATTATGATGAAGACGGAGAGGTTTTTGTTTCGAAAAGAGAACAGATAGAATCAGATCTTATTGAGTTTATTAAAAAAAATCTTACTGATAAGTATTCTTTTG | 0no label
|
G000007105 | ASM710v1 | GCF_000007105.1 | PRJNA224116 | SAMN02603579 | null | 2010/01/12 | Macrogen Inc. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/105/GCF_000007105.1_ASM710v1 | 637,000,356 | RS_GCF_000007105.1 | Monoisolate | Complete Genome | Full | na | Major | 264,203 | 542 | Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 | strain=ZM4 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Sphingomonadales | Sphingomonadaceae | Zymomonas | Zymomonas mobilis | true | Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 ZM4 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 2,056,363 | 1 | 46.33 | 2,056,363 | 1 | 1,753 | 604,103 | 86.562441 | 100 | 0 | 0 | 320 | yes | yes | yes | 20 | high | 1,220,830 | CGTCGAGCCTTGATGGATATTTTATGATGCCAGATGACCAAAAGAACGGCCAAGCGAATTTTTCTGATGTTGAGGGGATGACCCGACAAAACAGAAATCAAGCGATGGGTGCCATATCGGTTTCTGTGGCGATGGCCATTCTTGACACCG | 0no label
|
G000005825 | ASM582v2 | GCF_000005825.2 | PRJNA224116 | SAMN02603086 | null | 2010/12/15 | Center for Genomic Sciences, Allegheny-Singer Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/005/825/GCF_000005825.2_ASM582v2 | 646,311,908 | RS_GCF_000005825.2 | Monoisolate | Complete Genome | Full | representative genome | Major | 398,511 | 79,885 | Bacillus pseudofirmus OF4 | strain=OF4 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus pseudofirmus | true | Bacillus pseudofirmus OF4 | Eubacteria | Firmicutes | 1 | 0.995 | 1 | 1 | 4,249,248 | 3 | 39.86 | 3,858,997 | 1 | 4,260 | 1,228,222 | 85.144124 | 98.68 | 1.32 | 0 | 377 | yes | yes | yes | 20 | high | 440,180 | GCTGATCATGATTGGTTTAACCTTCACGATCACGATGGCGCTCACAGGATTTATCCTTTGGTTTATCTCAAGAAGGCTGACTGCTCCGCTAAGGGAGATGAATCGAATTGCTCTTCAACTTGCTAAAGGAGATTTTTCTCAGCATGTACG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,487,150 | CGCACGGGAGAACTGGATCCGAACCACGGGACAGATGTGGGTAAAGCACGAGGGGGAACGTGAGGAGGAAAAAGGGCATGAAGGAAAGACTCTGGAGAAATGACACCCGGGAGGAGTGCGGCTACACCGCAGGGCGGGCAGGCCCTGAAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 630,000 | CCGGTGTTTTCTGGGGCCGGTGCGGGACAGCCCCGGTGTGGGGGGCGCGTGGGGAGAGCCGGGGCCAGGCGGGGAGGATCCGGGCTGCAGGCAGGAGTGCGCGGGGCAGGGCCCGACCGCTCAGCCTCCCCGGGGCTCACACGGGAGGAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,177,000 | GGGCCTCCAGAACCAAGAGAAGACAGGGGAGTAGGGATTCTCCCAGGGCCCCCCAAAGACAGGAAGAGGGGGAAATGTATTCTCCCGGGGTCTCCAGAAGCAGCCAGCCCTGCCCGCAGTTTGGCTTTAGCTCCCTGGTACCCATCTCGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,638,150 | TGTACCCAAGAGATACGAAAATATATGTCCGTGAAAAACTTGTACACAAATGCTCATAGCGGCATTATTCCTAATAGTAAAAAAGCAGAAACGACCCAAATGTCCATCAGCAGATAAATGGATAAGTAAAATGTCACGTACATCCACACA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,253,000 | TCAGTCAGTCAGTCAGTCAGTCAGTCAGTGAACACCTCACAGTGACATCCTGTACCTGGACTTGCAGGTGCAGGCGCCAGACAGTGCGGAGGCTGGAGACGGCTGCTGTCCCCAGGACTGTGGGTGTCACTGTGCAGAAAGGACACCCAT | 11
|
G000007385 | ASM738v1 | GCF_000007385.1 | PRJNA224116 | SAMN02603680 | null | 2005/02/02 | NIAB, Rural Development Administration | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/385/GCF_000007385.1_ASM738v1 | 637,000,346 | GB_GCA_000007385.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 291,331 | 347 | Xanthomonas oryzae pv. oryzae KACC 10331 | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas oryzae | true | Xanthomonas oryzae pv. oryzae KACC 10331 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,941,439 | 1 | 63.69 | 4,941,439 | 1 | 4,831 | 1,427,680 | 85.113992 | 99.82 | 0 | 0 | 355 | yes | yes | yes | 20 | high | 191,360 | CGCTGTCGATCTGATCCATGGCCAGCGCTGTCTTGGTCTGAAACACGACCTGATCCGGAACGCCTGCCTTCTTGCGCCGCACAGTGTCTTGAGCCCACTGCTCGGGAAGATACAGCCGATAGCCCACTGGCAGGCTGCCGTGTTCGTTGG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,174,600 | TGTGAGCAGCACCCAGGTGATGCCCCATGGCAGCATGTCCCACATTCCTTCCATCTTTTAAAAAAAATTTTTCTCGGTGGCAGTCTTGCTCTGTCGCCTAGGCTGGGGTACAGTGGTGCAATCTCAGCTCATTGCAGCCTCAACCTCCCG | 11
|
G000007525 | ASM752v1 | GCF_000007525.1 | PRJNA57939 | SAMN02603675 | null | 2005/01/21 | Nestle Research Center, Switzerland | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/525/GCF_000007525.1_ASM752v1 | 637,000,031 | RS_GCF_000007525.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 206,672 | 216,816 | Bifidobacterium longum NCC2705 | strain=NCC2705 | null | Bacteria | Actinobacteria | Actinobacteria | Bifidobacteriales | Bifidobacteriaceae | Bifidobacterium | Bifidobacterium longum | true | Bifidobacterium longum NCC2705 | Eubacteria | Actinobacteria | 1 | 0.996 | 0.9 | 1 | 2,260,266 | 2 | 60.13 | 2,256,640 | 1 | 1,833 | 667,063 | 86.967994 | 100 | 0 | 0 | 289 | yes | yes | yes | 20 | high | 2,011,360 | TGAGCCTTCACGTACTGGCTCGGCCATTTTGCCGGCAAACCACTCCAGTGATTTGCGTCCCGAACCAACTTTGATGCATGAGCCGACCAGGGAGCGCACCATATTGCGGGCAAAGGCGTCCGCCACAATCGTGAACACTACCAGGCCGGA | 0no label
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Sinorhizobium meliloti 1021 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 6,331,000 | GAGTTGCGCTGCCAATGACCGCCCATGTGGCTGAATGAAGCCAATCGGTTTTCATACCGCTCCCACCGATATCGCGTGAAGGGCAAGCTACTACGATTCCACCCCTGCTAGAAGCTTAGCCACCACCTCGACTGCAACTGCGCACTTTCG | 0no label
|
G000006745 | ASM674v1 | GCF_000006745.1 | PRJNA57623 | SAMN02603969 | null | 2001/01/09 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/745/GCF_000006745.1_ASM674v1 | 637,000,333 | RS_GCF_000006745.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,277 | 666 | Vibrio cholerae O1 biovar El Tor str. N16961 | strain=N16961 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Vibrionales | Vibrionaceae | Vibrio | Vibrio cholerae | true | Vibrio cholerae O1 biovar El Tor str. N16961 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 4,033,464 | 2 | 47.49 | 2,961,149 | 1 | 3,594 | 1,184,587 | 86.533164 | 99.86 | 0.03 | 0 | 360 | yes | yes | yes | 20 | high | 3,792,490 | CGTTCGATCAGCAGCTAGCACTCAATACCTATTGGCAGCAGATAGGCGGAAGCAAATTTCTTCCAGGCACAATCAATGCCGCAGATCGCTTTGTCCGCGCCTCTTATGCTCTCAGTGCCTCACCTAAATACCGAGACAACGACCTTGCAC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,788,550 | TGAATAAAAGCTAATGTACTGGAGAGCTTGATGAGATCTAGGGACAGCATAGAAAGCCCCCTTCCCTCACTCTGCAGAACAGTTGCATCCATGTGACCCTGAGACAGAAGCCCTCTGCTCATTATCAAAGATGTGACAGCTGCCACTTGG | 11
|
G000010565 | ASM1056v1 | GCA_000010565.1 | PRJDA19023 | SAMD00060921 | null | 2007/05/07 | Marine Biotechnology Institute Co., Ltd | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/010/565/GCA_000010565.1_ASM1056v1 | 640,427,128 | GB_GCA_000010565.1 | Monoisolate | Complete Genome | Full | na | Major | 370,438 | 110,500 | Pelotomaculum thermopropionicum SI | strain=SI | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptococcaceae | Pelotomaculum | Pelotomaculum thermopropionicum | true | Pelotomaculum thermopropionicum SI | Eubacteria | Firmicutes | 0.98 | 1 | 1 | 1 | 3,025,375 | 1 | 52.96 | 3,025,375 | 1 | 3,001 | 887,464 | 86.415667 | 100 | 0.63 | 0 | 331 | yes | yes | yes | 20 | high | 2,916,030 | ACGTCCTCCGAGTTTTCCGTGCGCCCGCCGCAGGAGGCATGGTAGGCAGGGTCAATCAGCTCGCCCTGGTATGTAAGCACCTGCCCTTTTGTTTCGTCCACCGCCGTTTTGACCTTGTAATAATAATTATAGTAACGTAAGGTTCCCCAG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,908,900 | TCAGTTTCAATGAAGTCTAACGCCCTTAACCTTAGACTCTGCTGTGCTGCTGCTCTAAAACGTTTGACCATCATGGTTTAAAGCACTAAGAGGAAATAGCCATCTAGATTTTTTTAAGTGAGGGGGGCAAATTTGGGCTATCTTTGATCT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,302,450 | AACCTCCCTTTATGCTGAAGGGCCCTTGGGAACATGGGAACATTTGCACTTTGTCAGAGGAGTGGCCCCACCCTACTCTCTGCCTGAAACACAAAGCAGCTCCCCTCAGAACAGCCAGCCCGGTGCAGAAGCACTTGAACTTCTCATCTT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,738,000 | CCATCTGAGATTTTAAGTGAAAAAGCAAACATGTTTTAAAAATAATGGAAATGGTGGTGCGGACCTGGGCAGTATCCTGTTGGGGGTCGTATTAGAATCGTCAGCAATTCTAACAGGTGCAAGATGTAATTAGATGCCCGATGTTTGATC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,315,700 | CCACCTCCCTCCAGGTAGCGCATGGAAGGGGTGAGGGTAGGCTGGCAAGGAACAGAGGCCAGACCCAGCGGGACCAGGCAGCCCTGGGAAGGAGCTGGACTGTCATCTCCAGAGCAATGGGAGCCCCCTGCCCCCTTTAAGGCAGAGCTG | 11
|
G000008465 | ASM846v1 | GCF_000008465.1 | PRJNA224116 | SAMN02604184 | null | 2004/12/02 | University of Hawaii at Manoa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/465/GCF_000008465.1_ASM846v1 | 637,000,136 | RS_GCF_000008465.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 283,942 | 135,577 | Idiomarina loihiensis L2TR | strain=L2TR | null | Bacteria | Proteobacteria | Gammaproteobacteria | Alteromonadales | Idiomarinaceae | Idiomarina | Idiomarina loihiensis | true | Idiomarina loihiensis L2TR | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 2,839,318 | 1 | 47.04 | 2,839,318 | 1 | 2,658 | 892,961 | 92.667007 | 100 | 0.17 | 0 | 344 | yes | yes | yes | 20 | high | 1,420,770 | TGACAATGGCCATCTGCAGAATGACCTTAAAAGTGTCACGAATTTTCGGTGCGTTGAAGTCACTAAACGACTCTGCACAATCGCCGCCCTGCAGCAGGAAACCTTCTCCTACGCAGACATTCTTTAACTGGTTTCTTAACGCTCGTATCT | 0no label
|
G000009185 | ASM918v1 | GCF_000009185.1 | PRJNA224116 | SAMEA3138195 | null | 2006/06/22 | Max Planck Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/185/GCF_000009185.1_ASM918v1 | 637,000,129 | RS_GCF_000009185.1 | Monoisolate | Complete Genome | Full | na | Major | 362,976 | 293,091 | Haloquadratum walsbyi DSM 16790 | strain=DSM 16790 = HBSQ001 | null | Archaea | Euryarchaeota | Halobacteria | Haloferacales | Haloferacaceae | Haloquadratum | Haloquadratum walsbyi | true | Haloquadratum walsbyi DSM 16790 DSM 16790 = HBSQ001 | Archaea | Euryarchaeota | 1 | 0.997 | 0.9 | 1 | 3,179,361 | 2 | 47.86 | 3,132,494 | 1 | 3,071 | 845,315 | 78.317152 | 99.3 | 0 | 0 | 220 | no | yes | yes | 19 | medium | 919,750 | TGCGAACGCATCGAAGAAATCCTGATCTGTCGGAACAAACGCATGCGTTATGCGTAATCGCTGTGTTCGAGCTTCCACATCATTAATAAATGCATCAACGCGGTTACGATACTGCTCAAGAAGTCGTCCACCGAAATATGTCCGCTGACT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,077,950 | GCTATTATTCATGAAAGGTTTATTCATAATAGCCTAGGAACAACCCAAATGTGCAGCAACAGGGAAATAAACAAATCGTATATATGTACAATAAAATACTACACAAAGATCTAGTGATACATAAAATACCATGGACAAATCTCAAAAATT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,560,750 | TGTTTGCTTAGTGTGCTACATTGCATTTTGGGAACATTCATATTTCTGTTCATGGATGTTTCCAAAACGCATGCATGTACACACACACACACACACACACACTCAACATATAAAATAAACTCTAGGTGATTCTTTTCATTTTTTTGAGAC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,127,450 | TAGGGGCTGTGGCTCCAGCCACCATCTGGGACCATGGCGAGACCTTGAGAAGAAAACCATGCACCGGGGCAGACAGGAGGAGACTAGATACCTGAGGTTTAGGTCACTCTACCAACCCGGGGCAGCACACCCTGAAAACACCTCATTTTA | 11
|
G000008665 | ASM866v1 | GCF_000008665.1 | PRJNA224116 | SAMN02603985 | null | 1999/12/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/665/GCF_000008665.1_ASM866v1 | 638,154,502 | RS_GCF_000008665.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 224,325 | 2,234 | Archaeoglobus fulgidus DSM 4304 | strain=DSM 4304 | null | Archaea | Euryarchaeota | Archaeoglobi | Archaeoglobales | Archaeoglobaceae | Archaeoglobus | Archaeoglobus fulgidus | true | Archaeoglobus fulgidus DSM 4304 | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 0.9 | 2,178,400 | 1 | 48.58 | 2,178,400 | 1 | 2,518 | 688,447 | 93.086761 | 100 | 0 | 0 | 186 | no | yes | yes | 17 | medium | 411,060 | CTTGTTGCATCGAGAGCCTTTCTGGGCTTAACGCAGTCTCCAATCTTGTAGAGCTCGCTAACCTTGCCCTGAAGCTCGTCATACAGCCCATTGTTCGGCTTTGTACCGACAGCTATAACAGCAGTGTCACACTGCAACTCTTTCCTCTCA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,678,950 | CGAGATTGGATTCCTGGGGAAACTCTTTGGAATATATAAAACATAACTTACTTTTTAAACCAATGACAGGTAGTTGTATCGTTATCTGACTGGAAAACAGATGGTACATTCAAATTGCGTATTTGAAAAGGACTTGGGAAAGAGACTATT | 11
|
G000010825 | ASM1082v1 | GCF_000010825.1 | PRJNA224116 | SAMD00060943 | null | 2009/08/26 | Acetobacter pasteurianus genome sequencing consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/825/GCF_000010825.1_ASM1082v1 | 644,736,321 | RS_GCF_000010825.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 634,452 | 438 | Acetobacter pasteurianus IFO 3283-01 | strain=IFO 3283 substr. IFO 3283-01 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Acetobacteraceae | Acetobacter | Acetobacter pasteurianus | true | Acetobacter pasteurianus IFO 3283-01 IFO 3283 substr. IFO 3283-01 | Eubacteria | Proteobacteria | 1 | 0.982 | 0.9 | 1 | 3,340,249 | 7 | 53.1 | 2,907,495 | 1 | 3,156 | 1,006,859 | 88.810714 | 100 | 0 | 0 | 352 | yes | yes | yes | 20 | high | 1,281,800 | AATTTGCGATGGATCGGTAACCCCCATCTGGCGTGCAATGGTTGGCAGTTCAGATTGCAGGGCTGTGGCCAGATCATCGGCAGAAACCTGCTGTTGGCCCACTTTGGCAACAACATCCGTTTCTTCCCCCATATAGCCCATAACATCGCC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,196,350 | CCAACCCCGTGGGCCTCGGACAACCCTCCTGCCACACTGGCCCCTGCAGAGGAGGCTGAGTTTAGGCAGTTCAGGAGAGTGGGGTGTGGGCAAGAGCAGTTGAACCCTCAGTGGGCTCTAGAGGAGTCCCAGGCCACAGACTTATTGGGG | 11
|
G000009345 | ASM934v1 | GCF_000009345.1 | PRJNA57741 | SAMEA1705958 | null | 2007/01/12 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/345/GCF_000009345.1_ASM934v1 | 640,069,335 | RS_GCF_000009345.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 393,305 | 630 | Yersinia enterocolitica subsp. enterocolitica 8081 | strain=8081 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia enterocolitica | true | Yersinia enterocolitica subsp. enterocolitica 8081 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 4,683,620 | 2 | 47.22 | 4,615,899 | 1 | 4,253 | 1,352,606 | 85.086813 | 99.95 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 1,865,500 | ATCGCGCTGTAGGCCGCTGACATGGCTTTCAATCGCAACAGCGGGTTTTGTGGGTCGTCAATCAGATCAGACAGCAATGAGCCATAGGCACGACGCATACATCGCGTAGTGATCGGGGTGGTCACGATATCGGTTATCGACTGGGTAATA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,558,700 | GTCGGCTGGAGCCGCTGTAGGAGACAAGTCCAAGGTCGGGACGCTGTGGGCTTGGGCCTCGGGAAGTGGAGTGGCTGGGCCTCCACCTCCCTCCAGCCTGGGCTGGAAGTGGGGGATGGGGGATCCCAGGCCGTGCCCCCGGAAAAGAGG | 11
|