#genome
stringclasses 121
values | asm_name
stringclasses 120
values | assembly_accession
stringclasses 120
values | bioproject
stringclasses 45
values | biosample
stringclasses 120
values | wgs_master
float64 | seq_rel_date
stringclasses 98
values | submitter
stringclasses 76
values | ftp_path
stringclasses 120
values | img_id
float64 637M
2.51B
⌀ | gtdb_id
stringclasses 120
values | scope
stringclasses 3
values | assembly_level
stringclasses 1
value | genome_rep
stringclasses 1
value | refseq_category
stringclasses 3
values | release_type
stringclasses 2
values | taxid
float64 1.15k
681k
⌀ | species_taxid
float64 7
911k
⌀ | organism_name
stringclasses 120
values | infraspecific_name
stringclasses 112
values | isolate
stringclasses 1
value | superkingdom
stringclasses 2
values | phylum
stringclasses 18
values | class
stringclasses 30
values | order
stringclasses 56
values | family
stringclasses 75
values | genus
stringclasses 89
values | species
stringclasses 117
values | classified
bool 1
class | unique_name
stringclasses 121
values | lv1_group
stringclasses 2
values | lv2_group
stringclasses 13
values | score_faa
float64 0.93
1
⌀ | score_fna
float64 0.88
1
⌀ | score_rrna
float64 0.1
1
⌀ | score_trna
float64 0.6
1
⌀ | total_length
float64 618k
9.12M
⌀ | contigs
float64 1
22
⌀ | gc
float64 22.5
72.2
⌀ | n50
float64 616k
9.03M
⌀ | l50
float64 1
1
⌀ | proteins
float64 525
7.92k
⌀ | protein_length
float64 172k
2.68M
⌀ | coding_density
float64 74
96.9
⌀ | completeness
float64 76.3
100
⌀ | contamination
float64 0
4.4
⌀ | strain_heterogeneity
float64 0
100
⌀ | markers
float64 124
383
⌀ | 5s_rrna
stringclasses 2
values | 16s_rrna
stringclasses 1
value | 23s_rrna
stringclasses 1
value | trnas
float64 14
20
⌀ | draft_quality
stringclasses 2
values | start_position
int64 0
10M
| autotrain_text
stringlengths 150
150
| autotrain_label
class label 2
classes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
G000007805 | ASM780v1 | GCF_000007805.1 | PRJNA57967 | SAMN02604017 | null | 2003/03/05 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/805/GCF_000007805.1_ASM780v1 | 2,508,501,074 | RS_GCF_000007805.1 | Multiisolate | Complete Genome | Full | reference genome | Major | 223,283 | 251,701 | [Pseudomonas syringae] pv. tomato str. DC3000 | strain=DC3000 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas syringae group genomosp. 3 | true | [Pseudomonas syringae] pv. tomato str. DC3000 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.9 | 1 | 6,538,260 | 3 | 58.34 | 6,397,126 | 1 | 5,862 | 1,948,843 | 87.825109 | 100 | 0.22 | 0 | 381 | yes | yes | yes | 20 | high | 4,075,630 | ATTTAACTTTATTCAAGGATCATTCTTCGATGGTTAAAGCGATAGCCGAAAGTACTGCTATTCGAAGCAACGGGCACGCCTGGTGTACCGCTGATGATGACCGTTGTGTTGGCAACTCGACTGAACGTACCCGCTGCGGTGGCTGCACAA | 0no label
|
G000008045 | ASM804v1 | GCF_000008045.1 | PRJNA224116 | SAMN02603327 | null | 2004/08/19 | Human Genome Sequencing Center, Baylor College of Medicine | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/045/GCF_000008045.1_ASM804v1 | 637,000,246 | RS_GCF_000008045.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 257,363 | 785 | Rickettsia typhi str. Wilmington | strain=Wilmington | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rickettsiales | Rickettsiaceae | Rickettsia | Rickettsia typhi | true | Rickettsia typhi str. Wilmington | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 1,111,496 | 1 | 28.92 | 1,111,496 | 1 | 868 | 286,112 | 75.845617 | 99.66 | 0.33 | 0 | 211 | yes | yes | yes | 20 | high | 748,540 | CAAAAGTATATAAATCAAACGATATAGTATCGGCACAAAAAATACAAAATAATTCTATTAGAATTGGACTATTGTTATCATTGCCCGCAACATTTGGTATTATAATATTATCTCATCCAATTACTCATATAATTTATGAAAGAGGAGTAT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,357,700 | CGGACCGGCTGCTCCTGCAGGACATCTGCTGAGTCCAGAAGGAATCAGTGCACGACGCCCGCAGAGCCCCAAATGCCCTGGGAGATCAGCAGGACTTCAAAGACAAGCAGGGGCCTCGGTGGCCACCTGACTTCTCCCTAGGCAGCCTCC | 11
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Sinorhizobium meliloti 1021 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 1,411,410 | CGACATGGCGCTCTATCAGGCGAAGAACGGCGGACGGAACCGCGTCGTCGCTGCCGCTGCCTGATCCGCCGCACATGCTGAGCTTTTCAGGGCCTCGCGCGCGGGTTCCTTCAGGTTCCGTTTTTCTTCGCGTGGCCCGTGCCGGGGTAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,708,150 | TTTATCTATCTCTTCTTTTATTGCTAGTGCTTTTGGTGTTGCGTCAAAAAAAATTCTTAACACACAGCATAAGCATGAACTTTACTGCTATGTTTTCTCCTAGAAGAATCATAACTTTAGTTCTTACATTTATGTCTTTGATCTATTCAA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,957,950 | CTTCCTCTCTTTTCATCAATTACTGCATCTCGCATTGCCCCAGGGGAGCCGCTGTCAGGGTGGACATGTGGATGGATGGCTCCGATGTGTGTCAGCCCTGGGAGGAGAAAGTGGGGATTAGCTGACTTTCAAACAAGACACACACAAGGG | 11
|
G000007145 | ASM714v1 | GCF_000007145.1 | PRJNA57887 | SAMN02603845 | null | 2002/05/24 | Sao Paulo state (Brazil) Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/145/GCF_000007145.1_ASM714v1 | 637,000,344 | RS_GCF_000007145.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 190,485 | 339 | Xanthomonas campestris pv. campestris str. ATCC 33913 | strain=ATCC 33913 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas campestris | true | Xanthomonas campestris pv. campestris str. ATCC 33913 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 5,076,188 | 1 | 65.07 | 5,076,188 | 1 | 4,292 | 1,472,146 | 85.453159 | 99.64 | 0 | 0 | 358 | yes | yes | yes | 20 | high | 3,321,760 | TCTCAGCAACAGGATCGGTCGGAAGCGGCATGGACAGGATCGACGATGACGGGAACGCGACACGATACCGCGTCGCGGGCTCCGCCGCGCCTCTTGACGGCGGCACCGCCACCGCCTCCGGCCGCGAGCCCTGTAGCGGCGTGCGCGGTG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,007,100 | ACCCCTCCCCGCCTCTGGGGACTGGGCGACAGGAGGACATCCAGTCGGCTTTCTCAGAGGGTCCCCTTGCAGGCCCCATTGCTCACCCTTCACCTTGCAGACTGCGGCGGCCAACGTCTGCTATGTGGCCAGAGCCCTCTGGGGAGGGGC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,072,900 | CCCTGGCAAGAACCACCATCTCTCCTGGTGGCCACACAACCTCCTCACTGGACCGCCTTCCTCGACCTCCAATGTCCAGAGGTAGCTCCCCAAAGCAGGGGTATGGCCCCCACTCCCTTAAAACCCTCAGCCATGCAACAGGGGTGAGTG | 11
|
G000009125 | ASM912v1 | GCF_000009125.1 | PRJNA224116 | SAMEA3138192 | null | 2003/05/06 | Genoscope | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/125/GCF_000009125.1_ASM912v1 | 637,000,231 | RS_GCF_000009125.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 267,608 | 305 | Ralstonia solanacearum GMI1000 | strain=GMI1000 | null | Bacteria | Proteobacteria | Betaproteobacteria | Burkholderiales | Burkholderiaceae | Ralstonia | Ralstonia solanacearum | true | Ralstonia solanacearum GMI1000 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 5,810,922 | 2 | 66.98 | 3,716,413 | 1 | 5,062 | 1,725,241 | 87.482692 | 99.94 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 1,886,300 | TCCCGCTGTTCCGGGGCGGCCCGATGCTCTACGCCGACACCGTGGGCTTGTACAACGTCGCCCAGGCCATGCGCCGCTACGGCAAGGGTTACCACGGCGAAGCCTGGAAGCCGGCGCCGCTGCTGCAGAAGCTGGCCGACGCCGGCCAGG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 351,600 | AGGGGTGCCTCCAGCTTTGGACCCAGTCAGGGTCTTTTCTGGAAGACACCATGGGCCCCGGGTAGGCCCCCACACCCAGCCAGAAACCCAGGGCCAGCCCCATGCCCCTCCTTAACCACACTGTGGGCCTGAGCATGATGAGATGCTGGT | 11
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Nostoc sp. PCC 7120 ASM970v1 | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 1,025,440 | ATTTTCATAATTTTCTAGACTATAAGTTTTAATAATTCCAGAAATATGGAGATTCTTAGTAATGGTATATTGATTACGGAATTGTACTAATTCACTAAAGCTAGGATATTCATACCGCAACATTTTAATAACTATTGGCTTTTGATCTTC | 0no label
|
G000009905 | ASM990v1 | GCF_000009905.1 | PRJNA224116 | SAMD00061067 | null | 2004/09/02 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/905/GCF_000009905.1_ASM990v1 | 637,000,306 | RS_GCF_000009905.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 292,459 | 2,734 | Symbiobacterium thermophilum IAM 14863 | strain=IAM14863 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Symbiobacteriaceae | Symbiobacterium | Symbiobacterium thermophilum | true | Symbiobacterium thermophilum IAM 14863 IAM14863 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 3,566,135 | 1 | 68.67 | 3,566,135 | 1 | 3,297 | 1,051,001 | 86.832243 | 98.02 | 0.03 | 0 | 347 | yes | yes | yes | 20 | high | 852,020 | AGTGAACGGCACCCCGACTGAGAACCCGTCGGCCCTGGTGCGCATCCTCGATGCCGAGAGCGGCGCGGTCGTCACCTCCTTCGTGATGAACGGCGGCGGCCTGACCTACGAGGACGGCACCTACCGGGTGCAGTTCGATCCGCAGCGGTA | 0no label
|
G000010525 | ASM1052v1 | GCF_000010525.1 | PRJNA224116 | SAMD00060925 | null | 2007/10/16 | University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/525/GCF_000010525.1_ASM1052v1 | 641,228,476 | RS_GCF_000010525.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 438,753 | 7 | Azorhizobium caulinodans ORS 571 | strain=ORS 571 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Xanthobacteraceae | Azorhizobium | Azorhizobium caulinodans | true | Azorhizobium caulinodans ORS 571 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 5,369,772 | 1 | 67.32 | 5,369,772 | 1 | 4,810 | 1,620,542 | 88.922714 | 100 | 0 | 0 | 358 | yes | yes | yes | 20 | high | 4,980,040 | GCCTTGTCCGTCAGGGGCGCGCCCTCGTGCGTGACGTCTCTCTCAGCCTCATGCCCGGCACCGTCACCGTCATCGTCGGCCCAAACGGCGCGGGCAAGTCGAGCCTGCTCAAGCTGCTGGCCGGCGAGGTGAAGCCCAGTTCCGGGCGCG | 0no label
|
G000007145 | ASM714v1 | GCF_000007145.1 | PRJNA57887 | SAMN02603845 | null | 2002/05/24 | Sao Paulo state (Brazil) Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/145/GCF_000007145.1_ASM714v1 | 637,000,344 | RS_GCF_000007145.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 190,485 | 339 | Xanthomonas campestris pv. campestris str. ATCC 33913 | strain=ATCC 33913 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas campestris | true | Xanthomonas campestris pv. campestris str. ATCC 33913 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 5,076,188 | 1 | 65.07 | 5,076,188 | 1 | 4,292 | 1,472,146 | 85.453159 | 99.64 | 0 | 0 | 358 | yes | yes | yes | 20 | high | 4,791,410 | GCCGCCGCGTTCCAGCACGCCGGCCAGGGTGACGGTGAGTTCGGCCTGGTCCAGCACGCGCGCAGGTCCGGTGCCGAACACGTTTTCGACCTGGGCGCCCAGGCGCAACGGCGGGCGCAGGGCGTCGCGTTCGGCTTCGGCGGTGAGCAC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,960,500 | TTTAAAAAAAAAAAAAAAAAAAAAAAGGAAGTAAAAGCTTCATGTGGCCTGTACTGTTACTTCTCTATGGAAAGCCACAAGGCCTCAAAACCAGCAAAACATCTGCTTCTCAGAGACCAGCCTTTAGCTTGTGGTTTACCAGAAATGTAG | 11
|
G000010565 | ASM1056v1 | GCA_000010565.1 | PRJDA19023 | SAMD00060921 | null | 2007/05/07 | Marine Biotechnology Institute Co., Ltd | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/010/565/GCA_000010565.1_ASM1056v1 | 640,427,128 | GB_GCA_000010565.1 | Monoisolate | Complete Genome | Full | na | Major | 370,438 | 110,500 | Pelotomaculum thermopropionicum SI | strain=SI | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptococcaceae | Pelotomaculum | Pelotomaculum thermopropionicum | true | Pelotomaculum thermopropionicum SI | Eubacteria | Firmicutes | 0.98 | 1 | 1 | 1 | 3,025,375 | 1 | 52.96 | 3,025,375 | 1 | 3,001 | 887,464 | 86.415667 | 100 | 0.63 | 0 | 331 | yes | yes | yes | 20 | high | 1,638,130 | TTTACCTGTATTCTGGCCACGAATACGCATTCACGTTTGAGACAGAAACTGATGCAAGTGCTCTCGTCACCGCTACATTTAGCGATTTCTTTGAAAAAGAATTTGGCGGGACACAGCGGAAAATCTATTTCTATAGTATGAGTCTATCCA | 0no label
|
G000007785 | ASM778v1 | GCF_000007785.1 | PRJNA57669 | SAMN02603978 | null | 2003/03/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/785/GCF_000007785.1_ASM778v1 | 637,000,101 | RS_GCF_000007785.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,185 | 1,351 | Enterococcus faecalis V583 | strain=V583 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Enterococcaceae | Enterococcus | Enterococcus faecalis | true | Enterococcus faecalis V583 ASM778v1 | Eubacteria | Firmicutes | 0.99 | 0.991 | 1 | 1 | 3,359,974 | 4 | 37.38 | 3,218,031 | 1 | 3,271 | 1,000,353 | 87.714339 | 99.53 | 0.31 | 0 | 309 | yes | yes | yes | 20 | high | 1,710,410 | TTACTTTCTAAGGTTGGATAAAGTAAATCTGGACGATCGTCACGGATAATTGGACGATTGGTTGGGATTTGAATGACTTGAATATTGTAAATTTCACGGAATTCTTCTTCTTCTGTTTTAGCAGTACCAGTCATCCCGGCTAGTTTTTTG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,196,850 | CATCTATGTTTTGCTTTGCTTTTTTTTTGAAAAGGGGTCCCAGGGTTGCTTAAAAAAATTCAAAAGTCACCATTGGCCGGGCTCAGTGGCTCATGCCCATAATCCCAGCACTTTGGGAGGCCAAGGTGGGTGGATCACCTGAGGTCAGGA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,707,100 | CTAGTTCTGATGCCTGCTCTCTGTCTTTAAACTGTTTTTTCTGCCTTTAAATAAGACTTGCAATTTTTTTGCTGAAAGGCAGACATGATGTGCTGAAGAAAAGGCACTGAGCTAAGTGGGTTTTAGTGATGAGATGGTGAGGTCAGGGGA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,983,150 | TGTTAATGCACTTCGGCTCCATTTACCAGTTAACGATTTAGTGATCCCACTGAGAAGCCAGGAGCTCCAACAGCCACCGAGAAGCACAGCACCCAGCAGAGCTGCGTGTGGAGGCAACGCTCACCTCCCTCTCCATGGGACCTAAATGAC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,814,200 | ATGATTGAGTCTTATTGTAGCTCCTTAAGAAATGTCAAGGCTGGGCACGGTGGCTCACGCCTGTACTCCCAGCACCATGGGAGGCTGAGGCGGGTGGATCACAAGGTCAGGAGTTTGAGACCAGCCTGGTCAACATGGTGAAACCCCGTC | 11
|
G000007145 | ASM714v1 | GCF_000007145.1 | PRJNA57887 | SAMN02603845 | null | 2002/05/24 | Sao Paulo state (Brazil) Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/145/GCF_000007145.1_ASM714v1 | 637,000,344 | RS_GCF_000007145.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 190,485 | 339 | Xanthomonas campestris pv. campestris str. ATCC 33913 | strain=ATCC 33913 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas campestris | true | Xanthomonas campestris pv. campestris str. ATCC 33913 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 5,076,188 | 1 | 65.07 | 5,076,188 | 1 | 4,292 | 1,472,146 | 85.453159 | 99.64 | 0 | 0 | 358 | yes | yes | yes | 20 | high | 1,534,000 | CTGGTCGATCAGGTAGCCGTTGGCCGCGTGCACTTCCACGCCGTCGAAGCCAGCATCGATGGCGTTACGCGCAGCTGCGCGGTAGTCCTCGATCAGCGCGGGAATTTCCTCCAGCGCCAGTGCACGCGGCTCGGAGACATCAGAAAAGCC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,100,900 | ACCCTGCACCCCCAGGTGAGCATCTGACAGTCTGGAACAGCACCCACACACCCAGGCGAGCATCTGACAGCCTGGAACAGCACCCATACGCCCAGATGAGAATCTGACGGCCTGGAAAAGCACCCTGCACCCCCAGGTGCGCACCTGACA | 11
|
G000006845 | ASM684v1 | GCF_000006845.1 | PRJNA57611 | SAMN02604088 | null | 2005/02/14 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/845/GCF_000006845.1_ASM684v1 | 637,000,188 | RS_GCF_000006845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 242,231 | 485 | Neisseria gonorrhoeae FA 1090 | strain=FA 1090 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Neisseriaceae | Neisseria | Neisseria gonorrhoeae | true | Neisseria gonorrhoeae FA 1090 | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 2,153,922 | 1 | 52.69 | 2,153,922 | 1 | 2,142 | 609,210 | 83.31778 | 99.82 | 0.21 | 0 | 323 | yes | yes | yes | 20 | high | 1,526,330 | AAAGCGTCGCCGCAGGCACGGGCAAAGAATACGGCAGCCTGTTTGCCGGTACGACCGTCATCGGCATCATTTCCACCGCCGCCTGGGGCTTGGGCTATTTCGGACAGCCGCACATTTTGGCGCGCTTTATGGCCGCCGAAAGCGCGAAAT | 0no label
|
G000009865 | ASM986v1 | GCF_000009865.1 | PRJNA224116 | SAMD00061066 | null | 2005/06/30 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/865/GCF_000009865.1_ASM986v1 | 642,555,160 | RS_GCF_000009865.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 279,808 | 1,283 | Staphylococcus haemolyticus JCSC1435 | null | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus haemolyticus | true | Staphylococcus haemolyticus JCSC1435 | Eubacteria | Firmicutes | 1 | 0.989 | 1 | 1 | 2,697,861 | 4 | 32.78 | 2,685,015 | 1 | 2,600 | 785,925 | 85.820989 | 99.62 | 0 | 0 | 341 | yes | yes | yes | 20 | high | 387,660 | CTCAATGGGACAATGCAATCTTATGCACGTAACCAAAAAGAAGGTGCGTATATATGGGCGGATATAGACGCATGGATTAAAAACGATTTAACTTGGAAGACTATGAAACGAGATGAAGATTATTTAAAACTCGTAGATGGCGTTAAGGTC | 0no label
|
G000008625 | ASM862v1 | GCF_000008625.1 | PRJNA57765 | SAMN02603207 | null | 1999/12/22 | DIVERSA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/625/GCF_000008625.1_ASM862v1 | 637,000,010 | RS_GCF_000008625.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 224,324 | 63,363 | Aquifex aeolicus VF5 | strain=VF5 | null | Bacteria | Aquificae | Aquificae | Aquificales | Aquificaceae | Aquifex | Aquifex aeolicus | true | Aquifex aeolicus VF5 | Eubacteria | Bacteria | 1 | 0.994 | 0.9 | 1 | 1,590,791 | 2 | 43.3 | 1,551,335 | 1 | 1,776 | 514,666 | 95.304851 | 98.98 | 1.22 | 75 | 317 | yes | yes | yes | 20 | high | 1,514,630 | AAAGTATTAGAAAGGATAAAAGGGAAAGGAAAGGGTTAGTAGAGAACGATTACGTCCACCGCCCTTTGTTCGGGGTGCCTTTCCCCTATTAAATTTGCAAGCTCTTCACCGTAGGAAGCTATCCTTACTTTTTCAACGGGTATTCCGTTC | 0no label
|
G000010425 | ASM1042v1 | GCF_000010425.1 | PRJNA224116 | SAMD00061080 | null | 2006/12/05 | Gifu University, Life Science Research Center, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/425/GCF_000010425.1_ASM1042v1 | 639,633,010 | RS_GCF_000010425.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 367,928 | 1,680 | Bifidobacterium adolescentis ATCC 15703 | strain=ATCC 15703 | null | Bacteria | Actinobacteria | Actinobacteria | Bifidobacteriales | Bifidobacteriaceae | Bifidobacterium | Bifidobacterium adolescentis | true | Bifidobacterium adolescentis ATCC 15703 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 2,089,645 | 1 | 59.18 | 2,089,645 | 1 | 1,683 | 614,966 | 86.722338 | 100 | 0 | 0 | 284 | yes | yes | yes | 20 | high | 1,850,290 | CGTATTCGTCACAACAAAAGCGGGTGAACCGTTGATCGCTCAACGACTCACCCGCCCGAACAAGCCCCGTTGCCTGTCTGCTGGCCCGCTCAGACCGCCATCGGCGTATCGGATTCGCGGAAGCGCAGCACGAGCGCCAGTCCGGCTCCG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,926,450 | GGGCGGGGCCTCCTTAGCCAGGCTTGAGGGCTGATATCCTCAACCAGAAACCACTTGCCAGCACGGGCACTGGGCAGCTGCAGCCCACAGTTGGCCAGGCCTGGGTTGAGAGGGTCCTCCGGGACCATGCAGATCAGGCTGGGCTGAAGG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,795,950 | GGTACCCAGTTTCCATCAACCTACAAGGTACTCTTGGCCAATTCACCTTTAATGTTCCACCTGGAAAATTCTAAAGTAGAATTTTCCTGTATTCAGATCTTCCTTCCTTTTTTCCCCCACTTCCTTCTCTGGCATAATTTCCCCATGAAA | 11
|
G000007205 | ASM720v1 | GCF_000007205.1 | PRJNA224116 | SAMN02602979 | null | 2003/07/25 | ALTANA Pharma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/205/GCF_000007205.1_ASM720v1 | 637,000,071 | RS_GCF_000007205.1 | Monoisolate | Complete Genome | Full | na | Major | 182,082 | 83,558 | Chlamydophila pneumoniae TW-183 | strain=TW-183 | null | Bacteria | Chlamydiae | Chlamydiia | Chlamydiales | Chlamydiaceae | Chlamydia | Chlamydia pneumoniae | true | Chlamydophila pneumoniae TW-183 | Eubacteria | Chlamydiae | 1 | 1 | 1 | 1 | 1,225,935 | 1 | 40.58 | 1,225,935 | 1 | 1,055 | 372,698 | 89.583869 | 99.49 | 0 | 0 | 219 | yes | yes | yes | 20 | high | 849,030 | AAAAAATTTATGGATACTTTGTTTTTACTACAATTTCTTCTTTAGGCTGGTTTTTTGCATTGAGACGTAGGGAAAATCAATTAAAAACAGCAGCTGTTCAGCTTCTTCAAACAAAAATTAGAAAATTAACAGAAAATAATGAAGGGTTAA | 0no label
|
G000009985 | ASM998v1 | GCF_000009985.1 | PRJNA224116 | SAMD00061077 | null | 2005/12/01 | Tokyo University of Agriculture and Technology, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/985/GCF_000009985.1_ASM998v1 | 637,000,155 | RS_GCF_000009985.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,108 | 84,159 | Magnetospirillum magneticum AMB-1 | strain=AMB-1 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Rhodospirillaceae | Magnetospirillum | Magnetospirillum magneticum | true | Magnetospirillum magneticum AMB-1 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,967,148 | 1 | 65.09 | 4,967,148 | 1 | 4,628 | 1,522,305 | 90.298759 | 99 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 3,121,430 | CTCGAAGATCTTGTCGTGATAGGCGGGCTCGATGCCGATTCCGTTGTCGGCCAGGCTGAACCGCCACAGATCGGAGCCAGTCCGCTCGGCCGCGATGGCGATCTGCAGCGGCCGCTCCCGGCTCCGGTACTTGACGGCGTTGCCGATCAG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,183,900 | AACGTTTCAGCTCTGACAAGAGAGTCTGGAGATGACTTTGTGACAGATTTACAGAAAACTAATCAAAGGAAACGAATGAGACAATTACTAATAACACAGAGGAAAAAGTGTTAAGAAAGGCTAGGTAATCCTGGTATATGATCTGGGTCA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,250,100 | CCTGTTGCCCGCTGTGCTGTGCGCAGCCCTCCCTTTCCCACGGTCTTGGCTCTGCCAGTCACATCTTACCCCCTCCCAGCTCACTCTGCTCCAAAAACACCAGCCACAAGTACTTCCCCTCCCACACATCTTCCTCTAATCCTCTGTGGC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,765,200 | AGCTGAGATGTTCTTTCTGTGTGAAGCCCCAGGTGTGCCGGGCTGGGCTGTGTCCGGAATTACCCATCAAATGGGCCTGGGGAGGCCTGCTGGGCTGGCACCCTCCCGCGGCCTCCTCCCGCCGTCCTGCCCGCTGTGGCTGGCCAGTTC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,808,200 | GAAAGAATATTTGTTGTTCTGTTACTTTACTCTCATAATAGATTAATTACTTTATCTTTCAGAGTTGTCTTTTTTTTTGGAGACAGAGTCTCACTCTGTCACCCAGGCTGGAGTGCAGCGGCGCGGTCTCGGCTCACTTCAACCTCCGCC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,756,350 | GAGGGTGGGCTGCAAGGACGGGGGTGGGTCAAGGGAGAGCAAGGAGAGCAAGGGCCTGAGGAGGCTGGTTCCCTGCCCAGCGCTGGGCGGGCAGAGGGTGAGACCAGCCAAGCTGCACAGGCCCCAGGTGGGCAGGGTGAAGCCAGGGGC | 11
|
G000009145 | ASM914v1 | GCF_000009145.1 | PRJNA224116 | SAMEA3138193 | null | 2003/05/06 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/145/GCF_000009145.1_ASM914v1 | 637,000,195 | RS_GCF_000009145.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 228,410 | 915 | Nitrosomonas europaea ATCC 19718 | strain=ATCC 19718 | null | Bacteria | Proteobacteria | Betaproteobacteria | Nitrosomonadales | Nitrosomonadaceae | Nitrosomonas | Nitrosomonas europaea | true | Nitrosomonas europaea ATCC 19718 | Eubacteria | Proteobacteria | 0.98 | 1 | 0.9 | 1 | 2,812,094 | 1 | 50.72 | 2,812,094 | 1 | 2,670 | 848,291 | 88.875656 | 99.97 | 0.74 | 25 | 352 | yes | yes | yes | 20 | high | 830,180 | TGGGGCAGATCGGGCTGGCTGGACGTGAAATGCTGCCCGCCAGAGTGTTGTCGCAAGGGCAGCGCAGGAGAGTGGCTCTGGCTCGTTTGCTGGTGACTCGAACCAAGTTATGGATCCTGGATGAGCCCTTGACTGCTCTTGACGTTGCAG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 301,200 | TAGTTTTAATACCAGTGACATTAAGATGTATAACACAAAGATTCATATAAATAAAAATTACAACATTGAAAATAATATTAGATGACACTAAAACTATCGTAGAAATACACATTTATATAAAACAAAGTAACATCAAGTATTAAATAAATT | 11
|
G000007825 | ASM782v1 | GCF_000007825.1 | PRJNA57975 | SAMN02603340 | null | 2004/07/06 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/825/GCF_000007825.1_ASM782v1 | 637,000,017 | RS_GCF_000007825.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,900 | 1,396 | Bacillus cereus ATCC 14579 | strain=ATCC 14579 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus cereus | true | Bacillus cereus ATCC 14579 | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,427,083 | 2 | 35.29 | 5,411,809 | 1 | 5,541 | 1,546,426 | 83.933929 | 98.18 | 0.58 | 18.18 | 383 | yes | yes | yes | 20 | high | 4,674,020 | TGTCCAACGTACATCGCATTAAATGCCCGTCTTCCGCCTTCTGGCCAAACCGTACCAACCATCGCATACATCGATGGGAAGACCATTCCAGAACCGAAGCCGATTAACGCTAGCCATTCAACATATAACGGCCAACCGTGGAAGAACACA | 0no label
|
G000007485 | ASM748v1 | GCF_000007485.1 | PRJNA224116 | SAMN02603248 | null | 2003/02/24 | Genoscope | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/485/GCF_000007485.1_ASM748v1 | 637,000,331 | RS_GCF_000007485.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 203,267 | 2,039 | Tropheryma whipplei str. Twist | strain=Twist | null | Bacteria | Actinobacteria | Actinobacteria | Micrococcales | null | Tropheryma | Tropheryma whipplei | true | Tropheryma whipplei str. Twist | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 927,303 | 1 | 46.33 | 927,303 | 1 | 934 | 278,179 | 88.37435 | 76.27 | 0 | 0 | 224 | yes | yes | yes | 20 | medium | 877,110 | AAAGGCAAAGGTTAGAGTTTCCTTTAGGGATTCTTCTGGGGTTTTGTCAAACAGGGCATTGACGTCATTTACATCTGCCGATAGTGGGGAAACAGATGAGACTGTTAGGGTTGCGGTAGATGGTGCAGAGGTGTATAGGGGTTGACCGTA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,164,850 | TGTGTTTCTGTGACTTTCAAGACTCTAGTTAACGCAGGCCCCTCACATACGGATCCAGAACGCATTCCTCTTAAACTCAGCGCTGGGAAAGGAGAAAGGAAAACTTCTTCTTTCTTGAGGCCATGGTTTAGAGGATCAACACTTTTTTTT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,473,700 | TCACTGCAACTTCCACCTCCTGGGTTCAAGCAATTATCCTTGCCTCAGCCTCCCTAGTAGCTGGGATTACAGGCACGTGCCACCATGCCCAGCCAATTTTTGTGTTTTTGGTAGAGAGGGTTTCACCCTGTTGGCCGGGCTGGTCTCGAA | 11
|
G000010525 | ASM1052v1 | GCF_000010525.1 | PRJNA224116 | SAMD00060925 | null | 2007/10/16 | University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/525/GCF_000010525.1_ASM1052v1 | 641,228,476 | RS_GCF_000010525.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 438,753 | 7 | Azorhizobium caulinodans ORS 571 | strain=ORS 571 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Xanthobacteraceae | Azorhizobium | Azorhizobium caulinodans | true | Azorhizobium caulinodans ORS 571 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 5,369,772 | 1 | 67.32 | 5,369,772 | 1 | 4,810 | 1,620,542 | 88.922714 | 100 | 0 | 0 | 358 | yes | yes | yes | 20 | high | 3,704,870 | GCAAGGCGTGAAACGGAGCTAGCGGACGCAGGATCTGAGCCGGGGCGCTCCTGCCAAGACCGCCAATCCGCTTTGGCGCAGGTGGAAAAGAGGCTCAGGTCAGACGGAGATACCGTCGGCCAGTGTCACGGACGTATTACGGACCGGCAC | 0no label
|
G000007765 | ASM776v1 | GCF_000007765.1 | PRJNA57631 | SAMN02603970 | null | 2005/07/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/765/GCF_000007765.1_ASM776v1 | 637,000,086 | RS_GCF_000007765.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 227,377 | 777 | Coxiella burnetii RSA 493 | strain=RSA 493 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Legionellales | Coxiellaceae | Coxiella | Coxiella burnetii | true | Coxiella burnetii RSA 493 ASM776v1 | Eubacteria | Proteobacteria | 1 | 0.995 | 0.9 | 1 | 2,032,674 | 2 | 42.6 | 1,995,281 | 1 | 2,058 | 613,036 | 88.849515 | 100 | 0 | 0 | 308 | yes | yes | yes | 20 | high | 18,330 | ATAAACATGAGCAGACAGCCATCATTGACGAGACAAGTTTATAGGGACAAAAAAAACCAACCTTTAAACAAGCTACTTGTTTTTCTTTTTAATCTTCGTTCTGATAATCTCCCTACCGGTATTTGTCCTGGTCCTTTCCAAGAATTAGCA | 0no label
|
G000007305 | ASM730v1 | GCF_000007305.1 | PRJNA224116 | SAMN02604284 | null | 2002/02/27 | Utah Genome Center | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/305/GCF_000007305.1_ASM730v1 | 638,154,515 | RS_GCF_000007305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 186,497 | 2,261 | Pyrococcus furiosus DSM 3638 | strain=DSM 3638 | null | Archaea | Euryarchaeota | Thermococci | Thermococcales | Thermococcaceae | Pyrococcus | Pyrococcus furiosus | true | Pyrococcus furiosus DSM 3638 | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 0.9 | 1,908,256 | 1 | 40.77 | 1,908,256 | 1 | 2,102 | 594,193 | 91.722127 | 99.5 | 0 | 0 | 195 | yes | yes | yes | 19 | high | 139,100 | TACCGTCGGTTGGATATCCGGCGGGAAGCTGGGAGGCATCGGCTCCCAACCCTAAATACGTCCCGAGACCGATAGCGAACTAGTACCGTGAGGGAAAGCTGAAAAGCACCCCGGGAGGGGGGTGAAAAGAGCCTGAAACCGGGCGGCGAT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,964,700 | AGCTCCCTGTGGCCCTATTTCTGTCAGCTGCAGCAGAGTTCTAGAAGAAGTGCCTGGCGTGCTCTCTGTCCATTCCCACTCCTTCCATCAGTCACCATGCCCTCTAGATTCATTCTTCACTTCATGGAGTTTCCTGTTCGGCATGCTCCT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 406,650 | CCCGGGAACCGCCTCCCACTCCCCCCACCAACCCCGGGAACCGCCTGCCCCCGCCACCAACCCCGGGAACCGCCTCCCACTCCCCCCGCAACCCCGGGAACCGCCTCCCACTCCCCCCGCAACCCCGGGAACCGCCTCCCACTCCCCCCG | 11
|
G000009725 | ASM972v1 | GCF_000009725.1 | PRJNA224116 | SAMD00061113 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/725/GCF_000009725.1_ASM972v1 | 2,514,885,032 | RS_GCF_000009725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 1,148 | 1,148 | Synechocystis sp. PCC 6803 | strain=PCC 6803 | null | Bacteria | Cyanobacteria | null | Synechococcales | Merismopediaceae | Synechocystis | Synechocystis sp. PCC 6803 | true | Synechocystis sp. PCC 6803 ASM972v1 | Eubacteria | Cyanobacteria | 1 | 0.99 | 0.9 | 1 | 3,947,019 | 5 | 47.37 | 3,573,470 | 1 | 3,713 | 1,164,101 | 86.890968 | 99.78 | 0 | 0 | 349 | yes | yes | yes | 20 | high | 844,610 | GGCCCATCCTTTACGACGGGCTGGAATTCCCTTTGGTTTTACGATGGGGAACCACGATGCTTCCGGTGCTCTGGATCAAAATCGTCGTTTTCGGTTTCAAAATGAACGGGATTTGGCGGCCCGTTATTGGCGCAACCCGGCCCATGATCC | 0no label
|
G000006605 | ASM660v1 | GCF_000006605.1 | PRJNA224116 | SAMEA3283089 | null | 2005/06/27 | Bielefeld Univ | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/605/GCF_000006605.1_ASM660v1 | 637,000,085 | RS_GCF_000006605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 306,537 | 38,289 | Corynebacterium jeikeium K411 | strain=K411 = NCTC 11915 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Corynebacteriaceae | Corynebacterium | Corynebacterium jeikeium | true | Corynebacterium jeikeium K411 K411 = NCTC 11915 | Eubacteria | Actinobacteria | 1 | 0.996 | 1 | 1 | 2,476,822 | 2 | 61.35 | 2,462,499 | 1 | 2,137 | 751,284 | 89.378688 | 100 | 0.68 | 0 | 319 | yes | yes | yes | 20 | high | 1,141,920 | GGGCTGCATGCCGCCCCAGCGCACATCGGAGACCTTGACTACATCGCCGGATTGTGGGGCCTCGATCATCTTTCCGTCACCCAGGTACAGGGCAACGTGGCCCGGCCAGAACAGCATGTCGCCACGCTTGGCCTGCGAGGAAGGAACCTG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,395,450 | AAGGGCTGCTGCCTTCACTTCGCTGCAACAGTTGTCAAAAAGAAAGACAGTTCTCCCCAAGAATGTCAATTCGGCTTCTCTGCTACTGTGAGTCTCCCATCTACAAGGACAGCTCTGAGCCATTGGGCAGCAGAGCGCCTGGGATCTCAC | 11
|
G000009245 | ASM924v1 | GCF_000009245.1 | PRJNA224116 | SAMEA3138197 | null | 2006/03/02 | LLNL | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/245/GCF_000009245.1_ASM924v1 | 637,000,111 | RS_GCF_000009245.1 | Monoisolate | Complete Genome | Full | na | Major | 376,619 | 263 | Francisella tularensis subsp. holarctica LVS | strain=LVS | null | Bacteria | Proteobacteria | Gammaproteobacteria | Thiotrichales | Francisellaceae | Francisella | Francisella tularensis | true | Francisella tularensis subsp. holarctica LVS ASM924v1 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 1,895,994 | 1 | 32.15 | 1,895,994 | 1 | 2,100 | 571,581 | 88.799806 | 99.82 | 0.41 | 100 | 311 | yes | yes | yes | 20 | high | 1,480,050 | CAGTTGTGGCAAGCTTGCCGAAGAACTTGACTATAATGAAATTAACATAAATGTTGGCTGCCCAAGTGAAAGAGTTAAAAAAGGTAATTTTGGCTTATCATTAATGGCAGAGCCAGAGCTTGTAGCAGACTGTGTCAAAGCTATGAAAGA | 0no label
|
G000006725 | ASM672v1 | GCF_000006725.1 | PRJNA224116 | SAMN02603773 | null | 2004/06/04 | Sao Paulo state (Brazil) Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/725/GCF_000006725.1_ASM672v1 | 637,000,348 | RS_GCF_000006725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 160,492 | 2,371 | Xylella fastidiosa 9a5c | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xylella | Xylella fastidiosa | true | Xylella fastidiosa 9a5c | Eubacteria | Proteobacteria | 0.98 | 0.993 | 0.9 | 1 | 2,731,750 | 3 | 52.62 | 2,679,306 | 1 | 2,664 | 765,931 | 82.59299 | 99.59 | 0.18 | 0 | 325 | yes | yes | yes | 20 | high | 365,560 | AAGCCTCTGCGCTGATTGATGCCTTACGTGCATCTCGTACTGTATTACAGCATTTGAATACGCCATTGTCGAACAAGCTGATGTTGTCTGGCTTTTCGCAAGGTGGTCATACTGCAATGGCGACCCAGCGTGAAATTGAAGCGCATCTGT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 938,250 | GGCTGGTGGCATGTACATGGGCAGCAGTGGGGTGCAGGGCCGAGCTTGGGCGCCTCATTTCACAGAAGGAAACAAGGGGAGGTGAGAGACAGTGCCGCAGAGCCTCCCGAGAGGGAGGGCCAGTGTTGGTGAGGGCGTCTGGTTGTCCGG | 11
|
G000011065 | ASM1106v1 | GCF_000011065.1 | PRJNA62913 | SAMN02604314 | null | 2003/03/28 | Washington University Department of Molecular Biology and Pharmacology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/011/065/GCF_000011065.1_ASM1106v1 | 637,000,026 | RS_GCF_000011065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,186 | 818 | Bacteroides thetaiotaomicron VPI-5482 | strain=VPI-5482 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Bacteroidaceae | Bacteroides | Bacteroides thetaiotaomicron | true | Bacteroides thetaiotaomicron VPI-5482 | Eubacteria | Bacteroidetes | 1 | 0.998 | 0.7 | 1 | 6,293,399 | 2 | 42.86 | 6,260,361 | 1 | 4,944 | 1,919,297 | 89.876027 | 99.41 | 0.4 | 0 | 348 | yes | yes | yes | 20 | high | 1,617,720 | GGTACACGTACACCCGCAATCTTTTTCACGCCAAGATGAACATCATTCACCTTTATCAATGAAGCGTCAAACTCATTCCAAAGGGCGAACATGGCTTCATAGGCTTGAATTTGTTGTTCGAGCCTATCCTCCAGATCGGCAGCTTCCGTT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,930,500 | GGGACCAGCTCACACAGAGTCTCGGGCCTGCAGCAGTGCCCTGCTCCAGACAGGCAGGGGCATCATGCCATCCATGGGCATATCTAGGGGGCTGAGGGCTGGCCACGCTCCTGACCTGGCCTCCATCTCCCCATGGTGGTCACTCTGGCT | 11
|
G000008265 | ASM826v1 | GCF_000008265.1 | PRJNA224116 | SAMN02603345 | null | 2004/06/08 | Institut of Microbiology and Genetics, University of Goettingen | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/265/GCF_000008265.1_ASM826v1 | 638,154,512 | RS_GCF_000008265.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 263,820 | 82,076 | Picrophilus torridus DSM 9790 | strain=DSM 9790 | null | Archaea | Euryarchaeota | Thermoplasmata | Thermoplasmatales | Picrophilaceae | Picrophilus | Picrophilus torridus | true | Picrophilus torridus DSM 9790 | Archaea | Euryarchaeota | 0.99 | 1 | 0.8 | 0.9 | 1,545,895 | 1 | 35.97 | 1,545,895 | 1 | 1,599 | 485,076 | 92.441789 | 99.59 | 0 | 0 | 196 | no | yes | yes | 18 | medium | 601,900 | ATCTTTCTCTGCTGCACCCTTGCCTCCTGAAGGTAATAAAATATGATCTTTCTGTCAATCTCATCCATTGAAAAGTAAATAATTATACATTTAAATTTTTATCTATGCCATGGGAACATTTATAAAAATTATAATTATTGCATTATATGA | 0no label
|
G000009945 | ASM994v1 | GCF_000009945.1 | PRJNA224116 | SAMD00061108 | null | 2006/03/09 | Japanese Consortium/Yamaguchi Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/945/GCF_000009945.1_ASM994v1 | 637,000,067 | RS_GCF_000009945.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 264,202 | 83,556 | Chlamydia felis Fe/C-56 | strain=Fe/C-56 | null | Bacteria | Chlamydiae | Chlamydiia | Chlamydiales | Chlamydiaceae | Chlamydia | Chlamydia felis | true | Chlamydia felis Fe/C-56 | Eubacteria | Chlamydiae | 1 | 0.992 | 1 | 1 | 1,173,791 | 2 | 39.34 | 1,166,239 | 1 | 994 | 361,027 | 90.6353 | 99.49 | 0 | 0 | 223 | yes | yes | yes | 20 | high | 826,280 | TCTAAAGAAGAACCAAAAGCGACCAAACCATAACGCGAGACAGCTCCATACGAAGGCTTGAATCCGACAACACCGCAAAATGCTGCGGGCTGACGGATGGATCCTCCCGTATCAGAACCCAAAGCCATGGGGCAAAACCTTGCAGAAACC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,071,850 | GTGCCTGGCACCCGGGAAAGGCCAGCAGACATTTTAGAAGAACGCACTTTGCTGACGGACATGGAGTGAGGAATGTTTCACTCATGAGCTGGGTTTGGCGTCGGTTCTATGGTTTTCTGCAGAGTCCCCCTCTGGCTCCCCTGACACCCC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,432,200 | GTCTGAGTTTTCAAATGTATTGGCAAAAACCTGTTCATAGTAGTCTGTTATCGCATGGTAAGCTTTCATTCTACATAGATTAAGTAATGGAGCTTGGATGTGAAGCAGGCTATTGGAAGACTACTGCAGTAATCCAGGCCAGAAATAACA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,079,350 | AAATATAGCCGGGCGAGGTGGCACGCGCCTGTAGTCCCAACTACTCCGGAGGCTGAGGCAGGGGAATCGCTTCAACCCGGGATGCGGAGGTTGCAGTGAGCCGAGATTGCGCCACTGCACTCCAGCCTGGGGGACAGAGAGAGACTCTGT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,032,500 | CTTTGTTACAACTTCGGGAGGATGGAAGGGAGCAGGTGGTTGCAAGGAAGCAGCCCCAGAGAGCTGGAAGGAGGGTACTCTGCCCTGTGAACCACATCAGGGGACGTCCAGTGAATCCCAGCAGACCCAGAAGCCAGACCCCCAAGTATG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,867,750 | TCTCTGAGGACACTGTTGCTTACTTCCCTGTACTTTCTAAATGCTGTTGTTGGCCAATGGTATTACCATCCATCTGTTTTCTTTTAAGTGAATAAATGCACTCCTCACACACTCTGACATTTGTAGATATTTAAGTTTACCCTCCATAGA | 11
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Sinorhizobium meliloti 1021 | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 4,564,040 | CCTTGCCCACCTGGAGCAGCTAACGCTGCGCCGCCGCATCCCGCATGTCCTTCCCAGGATGCTTTCCAGATTATACGGCCGATATTCGCAGACGACTACAGGATGCTTCCGAATAGGGACGCATAGACAATCACTGCAATCGCCAGAGTA | 0no label
|
G000008765 | ASM876v1 | GCF_000008765.1 | PRJNA57677 | SAMN02603243 | null | 2002/11/22 | Genome Therapeutics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/765/GCF_000008765.1_ASM876v1 | 637,000,076 | RS_GCF_000008765.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,562 | 1,488 | Clostridium acetobutylicum ATCC 824 | strain=ATCC 824 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium acetobutylicum | true | Clostridium acetobutylicum ATCC 824 | Eubacteria | Firmicutes | 1 | 0.998 | 0.1 | 0.9 | 4,132,880 | 2 | 30.93 | 3,940,880 | 1 | 3,896 | 1,211,240 | 86.343567 | 100 | 0 | 0 | 345 | yes | yes | yes | 19 | high | 2,037,100 | TTATCATTTAAAGCTCCTATTGCTCCCCCACCACCAGCTAAACTTTGTCCCAACATAAATGCCCTCTGTGAGCTGGTCATTTGGAATAGGTTAATAGATACATCGCAGCTATCAAATTGTGTATCCTGGTCAACTTTTCTATTTTCTGCA | 0no label
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Nostoc sp. PCC 7120 ASM970v1 | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 2,477,410 | AATGTGCCAGAGTTGACTGGCGATCGCATCTATCGGAAAACTGGTTATGGTAAGTTGCTTAACTGTGTTATCTATCTTTACGTTGTATTGACACGGTACTGAGCCAAAATGTGCAACTTGAAAGTTGTGCATTTCGGCTCACACTTGTTT | 0no label
|
G000010625 | ASM1062v1 | GCF_000010625.1 | PRJNA224116 | SAMD00060936 | null | 2008/01/24 | Kazusa DNA Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/625/GCF_000010625.1_ASM1062v1 | 641,522,640 | RS_GCF_000010625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 449,447 | 1,126 | Microcystis aeruginosa NIES-843 | strain=NIES-843 | null | Bacteria | Cyanobacteria | null | Chroococcales | Microcystaceae | Microcystis | Microcystis aeruginosa | true | Microcystis aeruginosa NIES-843 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 5,842,795 | 1 | 42.33 | 5,842,795 | 1 | 5,605 | 1,591,543 | 80.239081 | 99.89 | 0.51 | 25 | 350 | yes | yes | yes | 20 | high | 1,622,140 | AAAATTGTCTGTTTTCGATCATAGTTTTATTTGGTTTCCATCCAATTGTCACCGGCTTTAATTTCTACCAAGAGAGGGATCGTCAAGGAGACAGCTTCTTCCATAGTCGTCTTGATTTTTGACTCTAGGGATGGCCATTCTTCCCTCGGT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,312,400 | AAAAACTTGCTGGTTTTTGCGGCTTGTGGGGTATCACGGATCCTACCAATGTGTGATGTCTCCCCCAGATGCCCAGCTTTAAAATTTCTCTCTTTTGTACTCTGTCCCTTTATTTCTCAAGCCAGCCAACGCTTAGGAAAATAGAAAAGA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,790,000 | CATGGCAGAGGAAAGCCCCCCCACCACCGGACACCTGGCATGTCCACCTGGGGAAAGGGCACTGGCCCTCTCTGGCAAGAGCTTCTCAGACCCCAGGGTAGGTGGACTTTGTGGTTTTCATCTCTGCCGAGCGTGGAGCCCAATCAAAGA | 11
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 3,903,510 | GGTGAACATGAAGATCGCTTTCGTCGGGAAGGGCGGCAGCGGAAAGACCACGCTGTCCTCGCTCTTCATCCGTCACCTCGCCGCCAACGAAGCCCACGTCATCGCCGTGGACGCCGACATCAACCAGCACCTGGGGGCCGCTCTCGGCCT | 0no label
|
G000010065 | ASM1006v1 | GCF_000010065.1 | PRJNA224116 | SAMD00061073 | null | 2004/12/16 | Nagoya University, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/065/GCF_000010065.1_ASM1006v1 | 637,000,307 | RS_GCF_000010065.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 269,084 | 32,046 | Synechococcus elongatus PCC 6301 | strain=PCC 6301 | null | Bacteria | Cyanobacteria | null | Synechococcales | Synechococcaceae | Synechococcus | Synechococcus elongatus | true | Synechococcus elongatus PCC 6301 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 2,696,255 | 1 | 55.48 | 2,696,255 | 1 | 2,691 | 815,460 | 89.10092 | 99.73 | 0 | 0 | 342 | yes | yes | yes | 20 | high | 2,470,780 | CTCGCAGTTGTTGGGCCGGACTCGGCTGACTCTGACGACGCTCTAGCCAATCCTGAAAAAGCTGCTGGACTTCGACAATGCAACCCGGTGCGATCGCGATCGGGGTTGCAACTTGAGGCTGACCGCCGATGTCGTAACTGATTTGCCAAC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,570,600 | AAACTTCACTTTCAGGGTGTACTGGGGGTGGGCGTGGAGGGAGGAGGAGGAGGGCGGGTTGTGGTCCCCGTGTCTGTGCGCCTTGGCTCATTGCTCCCCAACACTGACAGCCCCTCACCCCATTGTCGGATCTGTCCAGGGCTTCTAAGC | 11
|
G000008165 | ASM816v1 | GCF_000008165.1 | PRJNA58091 | SAMN02598266 | null | 2004/06/24 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/165/GCF_000008165.1_ASM816v1 | 637,000,015 | RS_GCF_000008165.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 260,799 | 1,392 | Bacillus anthracis str. Sterne | strain=Sterne | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Bacillus anthracis str. Sterne ASM816v1 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,228,663 | 1 | 35.38 | 5,228,663 | 1 | 5,471 | 1,495,624 | 84.251844 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 4,176,770 | GCCATTCTGGGAGATGTTTTCCAAAAGAAAAAGAGCCGCTTTACTGCGACTCTTTCATAACCATTACTCACCTTTATATGCTTTCATATAAATTTCTTTCAGCTCTGAAATGAGAGGTAATTTCGGATTAGCTGTTGTACATTGATCTTC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,594,000 | TGTCCCTCAGAGTTAGAACCAACAGAGTTTGTAGGTTTTCAGCTTCAGTACCTAGGTCACCAGCAGTGTCATCTACCGAGAAGGCAAAGCCTGGGGAAAAACAGGTTTGAGGAGGCAAATAAAAAAATCTCTGTTGCACACGTTACATGT | 11
|
G000007205 | ASM720v1 | GCF_000007205.1 | PRJNA224116 | SAMN02602979 | null | 2003/07/25 | ALTANA Pharma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/205/GCF_000007205.1_ASM720v1 | 637,000,071 | RS_GCF_000007205.1 | Monoisolate | Complete Genome | Full | na | Major | 182,082 | 83,558 | Chlamydophila pneumoniae TW-183 | strain=TW-183 | null | Bacteria | Chlamydiae | Chlamydiia | Chlamydiales | Chlamydiaceae | Chlamydia | Chlamydia pneumoniae | true | Chlamydophila pneumoniae TW-183 | Eubacteria | Chlamydiae | 1 | 1 | 1 | 1 | 1,225,935 | 1 | 40.58 | 1,225,935 | 1 | 1,055 | 372,698 | 89.583869 | 99.49 | 0 | 0 | 219 | yes | yes | yes | 20 | high | 93,210 | AACGCGCAGGATTTGAAGTTCGTGACGTGCACGCAAGTCATTATGGACGTATTTGTCCTATTGAAACTCCTGAAGGTCCAAATATTGGTCTGATCACCTCTCTTTCCTCTTTTGCTAAAATTAACGAATTTGGATTCATTGAAACTCCTT | 0no label
|
G000009745 | ASM974v1 | GCF_000009745.1 | PRJNA224116 | SAMD00061075 | null | 2003/10/03 | NHRI, Taiwan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/745/GCF_000009745.1_ASM974v1 | 637,000,337 | RS_GCF_000009745.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 196,600 | 672 | Vibrio vulnificus YJ016 | strain=YJ016 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Vibrionales | Vibrionaceae | Vibrio | Vibrio vulnificus | true | Vibrio vulnificus YJ016 | Eubacteria | Proteobacteria | 1 | 0.996 | 1 | 1 | 5,260,086 | 3 | 46.68 | 3,354,505 | 1 | 4,639 | 1,553,759 | 87.03525 | 100 | 0.14 | 0 | 369 | yes | yes | yes | 20 | high | 59,280 | ATCGGGTCGATCACTTGCACGTCTAGTGCAATGTTGTTGTTGTCACTATCAGAGAACAATGCATCTTGGCCAACTGCCAGATCTAAAGTGAGATCCAAGCTGTGTGACGTGCTTGGTGTGTTCAACTGCGCTCTGATGTTGTCGGCAACA | 0no label
|
G000006605 | ASM660v1 | GCF_000006605.1 | PRJNA224116 | SAMEA3283089 | null | 2005/06/27 | Bielefeld Univ | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/605/GCF_000006605.1_ASM660v1 | 637,000,085 | RS_GCF_000006605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 306,537 | 38,289 | Corynebacterium jeikeium K411 | strain=K411 = NCTC 11915 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Corynebacteriaceae | Corynebacterium | Corynebacterium jeikeium | true | Corynebacterium jeikeium K411 K411 = NCTC 11915 | Eubacteria | Actinobacteria | 1 | 0.996 | 1 | 1 | 2,476,822 | 2 | 61.35 | 2,462,499 | 1 | 2,137 | 751,284 | 89.378688 | 100 | 0.68 | 0 | 319 | yes | yes | yes | 20 | high | 507,650 | GATTTCGCCTCCGGCCGGCCGTCGACGGCGAAAGCTGCAATGGGCAGTGCCGGGCCGGAGGCGGAGACTGAAAAGCCTAGCCAGGACTCAATGGCGGCAGCAGCAAGCTCTGCGGGAACGAATGGCAATTGGATACCACTGGCTTCGGTG | 0no label
|
G000008565 | ASM856v1 | GCF_000008565.1 | PRJNA57665 | SAMN02603976 | null | 2000/12/11 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/565/GCF_000008565.1_ASM856v1 | 637,000,092 | RS_GCF_000008565.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,230 | 1,299 | Deinococcus radiodurans R1 | strain=R1 | null | Bacteria | Deinococcus-Thermus | Deinococci | Deinococcales | Deinococcaceae | Deinococcus | Deinococcus radiodurans | true | Deinococcus radiodurans R1 ASM856v1 | Eubacteria | Terrabacteria | 1 | 0.991 | 0.8 | 1 | 3,284,156 | 4 | 66.61 | 2,648,638 | 1 | 3,248 | 987,980 | 88.625967 | 98.72 | 0 | 0 | 359 | yes | yes | yes | 20 | high | 2,061,930 | CGTGCCAGCACTGCTTTCCATCTTCACGATGATGCGGGGTCCGTCTTTCGCCATGATGCTCTCCTTTGCGCAGCCTTCCCTTTGGTCGCCAGGGACCGGGAAAGTTGCTCCCAGCGCCTGCCGGAGCAGGAACAACGCTGGTAAAAACCC | 0no label
|
G000008865 | ASM886v1 | GCF_000008865.1 | PRJNA57781 | SAMN01911278 | null | 2004/05/11 | GIRC | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/865/GCF_000008865.1_ASM886v1 | 637,000,108 | RS_GCF_000008865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 386,585 | 562 | Escherichia coli O157:H7 str. Sakai | strain=Sakai substr. RIMD 0509952 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Enterobacteriaceae | Escherichia | Escherichia coli | true | Escherichia coli O157:H7 str. Sakai Sakai substr. RIMD 0509952 | Eubacteria | Proteobacteria | 1 | 0.996 | 0.9 | 1 | 5,594,477 | 3 | 50.48 | 5,498,450 | 1 | 5,399 | 1,663,868 | 87.620737 | 99.97 | 0.33 | 0 | 374 | yes | yes | yes | 20 | high | 2,479,360 | CAAAGAACAGTCACTGGAAAGTCTGGTCCGACAGCTTCTGGAGATGCTGGAAATGGTCACTGATATGGAATCAACCTACCTGACCAAAGTGGATGTCGAAGCGCGCCTGCAGCATATTATGTTTGCCCGTAACAGCCAGAAAATGCACAT | 0no label
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 3,183,960 | CGGCGAAGGCCGCCAAGAGCGAGCAGACCCGCACGCTGATTCTCGAAACGGCGCTCCGGCTCTTCGCGGAGCGCGGCTACGACCGGACGACCATGCGGGCCATCGCCCAGGAGGCGGGCGTCTCGGTCGGGAACGCCTACTACTACTTCT | 0no label
|
G000007345 | ASM734v1 | GCF_000007345.1 | PRJNA224116 | SAMN03081414 | null | 2002/04/03 | Broad Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/345/GCF_000007345.1_ASM734v1 | 638,154,508 | RS_GCF_000007345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 188,937 | 2,214 | Methanosarcina acetivorans C2A | strain=C2A | null | Archaea | Euryarchaeota | Methanomicrobia | Methanosarcinales | Methanosarcinaceae | Methanosarcina | Methanosarcina acetivorans | true | Methanosarcina acetivorans C2A | Archaea | Euryarchaeota | 0.98 | 1 | 0.8 | 0.9 | 5,751,492 | 1 | 42.68 | 5,751,492 | 1 | 4,884 | 1,470,904 | 75.340086 | 99.84 | 0.03 | 0 | 229 | no | yes | yes | 18 | medium | 2,603,380 | GGTATCACCATAAAACTCAGTAGTAGCTTTCATGTCATAAATTTCATGACCATGATGATGTCCACCCGTCGTTCCAGTATAATGACCTATAATGTATTTCATACATTTCTTATATATTTCATTTTTAACATCCAAACAGTCGCTACAAGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,973,250 | TTCAGATAAACGCAAACGGACCATCTTCAGAGCGTGCTGCGGGGCACATTTCTTTGGCAGATGAGCTCATGTTGACCTGGGATCATTGTAAAGGATTGCTGAGGGCACAGCATGGGGGTGTTGGGGAGGGAAAATGACACCTGATCCCAA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,790,850 | AGCCTCCAGAGGACCTGCTCAGCACACAGTGTGGGAGCACCCTTAGGATGCCAGGCTTTGAATCTAAAGCTTGTGTCATAGCCCAGGGTAACTGTCTAACTTACTTCTCCAGCCTGATCTTCCTCTTGACCTCTGTGTAAGAGGCTATTG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,323,100 | AACTCCTGAGACTTAAACTAAATGAATTTATGTCTTTATTTAGCCCAACGGGGATGTAAAAATACCAGGCAGAGCACATTACAGAAAACCCATGATGAGTAGTAACGTAAAATGTGTGTTTCTGCTGCCCAAATGGAAAGGCCTGCAGCT | 11
|
G000007305 | ASM730v1 | GCF_000007305.1 | PRJNA224116 | SAMN02604284 | null | 2002/02/27 | Utah Genome Center | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/305/GCF_000007305.1_ASM730v1 | 638,154,515 | RS_GCF_000007305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 186,497 | 2,261 | Pyrococcus furiosus DSM 3638 | strain=DSM 3638 | null | Archaea | Euryarchaeota | Thermococci | Thermococcales | Thermococcaceae | Pyrococcus | Pyrococcus furiosus | true | Pyrococcus furiosus DSM 3638 | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 0.9 | 1,908,256 | 1 | 40.77 | 1,908,256 | 1 | 2,102 | 594,193 | 91.722127 | 99.5 | 0 | 0 | 195 | yes | yes | yes | 19 | high | 377,650 | ACGAGTACGTAAGGATACTCTACGAAAAGATAAAGAAGTACGTTGATGTTCCAATTAGCATTTTAGATCCCTATTTACTCTTAGCCGCATGGAAGGAGTTTTACCTCTACGTAACCAAGCACAAGCTCGACATCCACCTATGGACGGAGT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,566,850 | CTGGGCAACAGAGCGAGACTCCATATCAAAAAAAAAAAAATGCAGCTTTGGGAAACAGTAACTGACACACACTGTTACTAGGAATATATATATTGGTTTGATCTTTATTTTTTTTTTTTTTTGCCATATTTTAAACACAATGGTTAAAAT | 11
|
G000009845 | ASM984v1 | GCF_000009845.1 | PRJNA224116 | SAMD00061121 | null | 2007/12/15 | The University of Tokyo, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/845/GCF_000009845.1_ASM984v1 | 637,000,202 | RS_GCF_000009845.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 262,768 | 100,379 | Onion yellows phytoplasma OY-M | strain=onion yellows | null | Bacteria | Tenericutes | Mollicutes | Acholeplasmatales | Acholeplasmataceae | Candidatus Phytoplasma | Onion yellows phytoplasma | true | Onion yellows phytoplasma OY-M onion yellows | Eubacteria | Terrabacteria | 0.93 | 1 | 0.9 | 1 | 853,092 | 1 | 27.76 | 853,092 | 1 | 956 | 230,005 | 79.395423 | 98.57 | 0 | 0 | 124 | yes | yes | yes | 20 | high | 514,410 | TTGTTATAGAACTTTTAATATAACCTATAATACTACCAAAAACATCAATAAAAATTTTTAATATTTGCATTAAAAAATCAAACAATGAACTAAATAATTTTAAAGGATAAATTAAAATTATTAATTGTTCCCATATAAAAACAAATATAG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,369,600 | TACTGGCACGCGGGGTCACGGCTGCTCTGCCTGTCCAGCCTCAGCTTCCCCTTGAGTAAAATGAAAGGCTTGGCTAGGTGGGCTCTGCAGGCCCCTTCCAGCCCTCGCAGCTGGGGATTGCAATCGTCACCTTATTCTAGGTTGGTTTTC | 11
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Nostoc sp. PCC 7120 ASM970v1 | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 2,100,930 | TTAGTCAAGCTAATTTGAGCGGATGTAATCTCAGTCGTGCTAATTTAACTGATGCAGACTTGAGTGGAGCTAACTTGAGTGGAGCTAACTTGAGTGAAGTCAACTTCATCGGTGCAGACTTAATTAGCACCAATTTAAAACAAAGCAATC | 0no label
|
G000008165 | ASM816v1 | GCF_000008165.1 | PRJNA58091 | SAMN02598266 | null | 2004/06/24 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/165/GCF_000008165.1_ASM816v1 | 637,000,015 | RS_GCF_000008165.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 260,799 | 1,392 | Bacillus anthracis str. Sterne | strain=Sterne | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Bacillus anthracis str. Sterne ASM816v1 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,228,663 | 1 | 35.38 | 5,228,663 | 1 | 5,471 | 1,495,624 | 84.251844 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 3,484,000 | TCGATGATTGTTAGTGCTGTAAGTATCATTCCTAGTATCAGTGCTAACTTTGCCAATTTGTTTCCCCCCTTTCGTTCTTTCTATATTTATTATACCATATCTATTTACCTAAGTAAACAGATATGGTGCGATTTCTCTTTAATTTTATTA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,040,350 | CGAGCCGAGATCATGCCACTGCACTCCAGCCTGGGTGACAGAGCAAGACTCCATCTTGAAGGAAAAAAAAAAAAAGAAAATTGGCCAGCCGCGGTGGCTCAAGCCTGTAATCCCAGCACTTGGAGAGGCTGAGGCAGGTAGATCACCTTA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,365,000 | TGCATCTGCAGTAATGTGTGTGGGGGTGAGAACCATCACCGAGTGGCTTTCGCTAAGTTGAATGAAATCCATTTTGAATCACTGCATTCATTGAAATCCCATGTGAGCCAACTGTCCCTTACATGCCCTTCCTCACTTAGGCCTTCGGCA | 11
|
G000009065 | ASM906v1 | GCF_000009065.1 | PRJNA57621 | SAMEA1705942 | null | 2003/05/06 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/065/GCF_000009065.1_ASM906v1 | 637,000,351 | RS_GCF_000009065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 214,092 | 632 | Yersinia pestis CO92 | strain=CO92 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia pestis | true | Yersinia pestis CO92 ASM906v1 | Eubacteria | Proteobacteria | 1 | 0.994 | 1 | 1 | 4,829,855 | 4 | 47.64 | 4,653,728 | 1 | 4,298 | 1,371,586 | 83.669593 | 99.82 | 0 | 0 | 372 | yes | yes | yes | 20 | high | 3,485,690 | GGAATGTAACGAAATAGCACCGGAAACGGCTCTCGCAGCATTGGCTATCGTACAACTTGATTACCAACGTAAACTTCGCCATAAAGAATCAGACTGAACCTACTACTTCTGATGTGTACTGAGGCGACTCGGCACGACATCGCCTCTGCT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,269,550 | GGAATAGAGAGCTTTTCCTGAGATGCTGGGAGCTCTCTACTAACCATTTCATTCAGTGACTCTGAAGTCCCCAGAGAGGGACGCATCCCAGAGCAAGGTCCGGGCCCCCTTAACGTGGACACCGCTGTGATTTGTTTGCAGGACTCCCTG | 11
|
G000007985 | ASM798v2 | GCF_000007985.2 | PRJNA57743 | SAMN02603989 | null | 2012/07/31 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/985/GCF_000007985.2_ASM798v2 | 637,000,120 | RS_GCF_000007985.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,231 | 35,554 | Geobacter sulfurreducens PCA | strain=PCA | null | Bacteria | Proteobacteria | Deltaproteobacteria | Desulfuromonadales | Geobacteraceae | Geobacter | Geobacter sulfurreducens | true | Geobacter sulfurreducens PCA | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,814,128 | 1 | 60.94 | 3,814,128 | 1 | 3,417 | 1,176,369 | 90.878544 | 99.35 | 0 | 0 | 363 | yes | yes | yes | 20 | high | 1,587,820 | CCTGATCGGGTTCATGGAAGGCCGTGATTTCTTCGGATGGGGAGACGGAAGAACCCTTGGGTATCTCTTTTTCTGCGTGGGAATATCGCTGTCGATCCTGGGTGTACTTCTGATGCGCATCTTCAGGAACCGGGGATTTTCATGAAAGAA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,485,500 | ACCAAGAGCTCACATACCGAGAAACTAAAAGGGGCCCCAGAGAACAACCTCTCCCATACCAGAGCTGCTCCTCCTGGGGCTGAGACAGGCCCTGCGCTTCGCCTGCTGGATGTGGGGCAGGAGGATATCCAAGCACTGCCATCCTGCCGG | 11
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Streptomyces griseus subsp. griseus NBRC 13350 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 3,284,580 | CCTCGGCGTACGTGTCCAGGGCGCGGGCGGGCCCGGCCTTCGGCGCGGCCTCGCCCGGCTGGCCGGCGGCGGGCTTCGCGGGTCCGCCGGAGGCTCCCGCGCCACCGCCGCCCGTCTCCGCCGCGCACCCGGAGGCGACGGCGGCGGCCA | 0no label
|
G000009985 | ASM998v1 | GCF_000009985.1 | PRJNA224116 | SAMD00061077 | null | 2005/12/01 | Tokyo University of Agriculture and Technology, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/985/GCF_000009985.1_ASM998v1 | 637,000,155 | RS_GCF_000009985.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,108 | 84,159 | Magnetospirillum magneticum AMB-1 | strain=AMB-1 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Rhodospirillaceae | Magnetospirillum | Magnetospirillum magneticum | true | Magnetospirillum magneticum AMB-1 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,967,148 | 1 | 65.09 | 4,967,148 | 1 | 4,628 | 1,522,305 | 90.298759 | 99 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 923,780 | GGAAGAAGCCGTAGCGCACGGTGATGCGGTAGAAGCCCTCGGCCAGCCCCTCCACCACCACCCGGTCGCGGGCGGAAACGCGGGGAATGTCCTCGGTGATCACCGTCAGGAACACCACTCGCTGGTGCAGCACCTTGTTGTGCTTGAGAT | 0no label
|
G000009745 | ASM974v1 | GCF_000009745.1 | PRJNA224116 | SAMD00061075 | null | 2003/10/03 | NHRI, Taiwan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/745/GCF_000009745.1_ASM974v1 | 637,000,337 | RS_GCF_000009745.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 196,600 | 672 | Vibrio vulnificus YJ016 | strain=YJ016 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Vibrionales | Vibrionaceae | Vibrio | Vibrio vulnificus | true | Vibrio vulnificus YJ016 | Eubacteria | Proteobacteria | 1 | 0.996 | 1 | 1 | 5,260,086 | 3 | 46.68 | 3,354,505 | 1 | 4,639 | 1,553,759 | 87.03525 | 100 | 0.14 | 0 | 369 | yes | yes | yes | 20 | high | 822,120 | CATCTAGCGCCTGAGGCTTCAGAGGGTCGTGTCATGGTGTGAAGTTGCCACTCAATTAAACAACGAGTAGTACGCTTTATACTGGCATTGGCGATAGCTCCCATGAGCTCTGGTAGTTCTGTCGGCGCCAATGCTGCCATATTTTCTTTT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,058,700 | GGAGAGAGAGGGCAAGCCTTGGGGAATGGGAAACCAGAATGCTGCCCACAGTGAGGGAATCTTTGGGTTGGCTCCGCCCTTGGACTTCTCTAATACAGAAGCCAGACAAATTTCATTTTTGCTTAAACTGTTTTGAGTGGGGTTTCTTCC | 11
|