#genome
stringclasses 121
values | asm_name
stringclasses 120
values | assembly_accession
stringclasses 120
values | bioproject
stringclasses 45
values | biosample
stringclasses 120
values | wgs_master
float64 | seq_rel_date
stringclasses 98
values | submitter
stringclasses 76
values | ftp_path
stringclasses 120
values | img_id
float64 637M
2.51B
⌀ | gtdb_id
stringclasses 120
values | scope
stringclasses 3
values | assembly_level
stringclasses 1
value | genome_rep
stringclasses 1
value | refseq_category
stringclasses 3
values | release_type
stringclasses 2
values | taxid
float64 1.15k
681k
⌀ | species_taxid
float64 7
911k
⌀ | organism_name
stringclasses 120
values | infraspecific_name
stringclasses 112
values | isolate
stringclasses 1
value | superkingdom
stringclasses 2
values | phylum
stringclasses 18
values | class
stringclasses 30
values | order
stringclasses 56
values | family
stringclasses 75
values | genus
stringclasses 89
values | species
stringclasses 117
values | classified
bool 1
class | unique_name
stringclasses 121
values | lv1_group
stringclasses 2
values | lv2_group
stringclasses 13
values | score_faa
float64 0.93
1
⌀ | score_fna
float64 0.88
1
⌀ | score_rrna
float64 0.1
1
⌀ | score_trna
float64 0.6
1
⌀ | total_length
float64 618k
9.12M
⌀ | contigs
float64 1
22
⌀ | gc
float64 22.5
72.2
⌀ | n50
float64 616k
9.03M
⌀ | l50
float64 1
1
⌀ | proteins
float64 525
7.92k
⌀ | protein_length
float64 172k
2.68M
⌀ | coding_density
float64 74
96.9
⌀ | completeness
float64 76.3
100
⌀ | contamination
float64 0
4.4
⌀ | strain_heterogeneity
float64 0
100
⌀ | markers
float64 124
383
⌀ | 5s_rrna
stringclasses 2
values | 16s_rrna
stringclasses 1
value | 23s_rrna
stringclasses 1
value | trnas
float64 14
20
⌀ | draft_quality
stringclasses 2
values | start_position
int64 0
10M
| autotrain_text
stringlengths 150
150
| autotrain_label
class label 2
classes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
G000008745 | ASM874v1 | GCF_000008745.1 | PRJNA57811 | SAMN02603115 | null | 1999/12/22 | ChGP | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/745/GCF_000008745.1_ASM874v1 | 637,000,069 | RS_GCF_000008745.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 115,713 | 83,558 | Chlamydophila pneumoniae CWL029 | strain=CWL029 | null | Bacteria | Chlamydiae | Chlamydiia | Chlamydiales | Chlamydiaceae | Chlamydia | Chlamydia pneumoniae | true | Chlamydophila pneumoniae CWL029 | Eubacteria | Chlamydiae | 1 | 1 | 0.9 | 1 | 1,230,230 | 1 | 40.58 | 1,230,230 | 1 | 1,063 | 373,983 | 89.578859 | 99.49 | 0 | 0 | 219 | yes | yes | yes | 20 | high | 192,530 | AAAGGCTCTCTATGGTTTTTTTTCACAATTTCCACTAAATGCCCACAAACGATAGGTAGACCTTCCAATAGGATAGCGTCCTAAAAAGGAGTTAGCTGGTCTTTTCGCTGGCAAAAATTCTAAGTAGATATGAGATCAGCTCGTGCAGCT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,295,400 | ATGCTATGCATGCAGCTGCTGGAAAAATTCTAGAGCTCCCACTGGGTGTTTTTCCGACTTCATTTTTGGATCAGCGGGTACCCCCGCCCCATCCTACCACTTTCTGATATGTGTCATCTGCACAGATGAGGATGCGGTAGCATTTTCTTT | 11
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2 | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 6,051,110 | GTCCGGCGATCTGCCCAAGGCCATCGCCTGTGGCGCCGACTCGGTGATGATGGGCTCGCCGCTCGCGCGCGCCACGGACGCGCCGGGCAGGGGCCACCACTGGGGCATGGAGGCTGTCAACGAGGAGCTGCCGCGCGGCAAGAAGGTCGA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,179,400 | AGCGGTAACACACGGCTGGGAATGAAGCGCTTTCTTTTTTAAGTGGCTAATTGCATCCTTTCATAAATAAAGATGAGAAAAACCCTGGGCAGACTCTCATTCCAGCTGCTTGGTGTGCTGTGCCTCATTAACTCGAGCCCTTGCTGTACT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,862,250 | TCTGTTGGTCTGTTTTTACTTTGTTTTTTGTTTTTGTTATGTTTTGAGAAAGGGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGGTACCATCATAGCTCACTGTGGCCTCAAACTCCTGGCCTCAAGTGATCCTCCCACCTTAGCCTC | 11
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Pseudomonas putida KT2440 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 5,499,520 | GGCAGGCGCAAGCAGGGGACGACTGGCGAGAAGTCGAGGATTGGGCAGGGTTGATCGAAGCACTGAAGCCGTTCCGCAGGCCACTGTTCACGCTAGGACGCGAGCCGCTGCAGCACCTGGACGAGATTCCGCCGGAGCAGTTCTGGACCT | 0no label
|
G000008765 | ASM876v1 | GCF_000008765.1 | PRJNA57677 | SAMN02603243 | null | 2002/11/22 | Genome Therapeutics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/765/GCF_000008765.1_ASM876v1 | 637,000,076 | RS_GCF_000008765.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,562 | 1,488 | Clostridium acetobutylicum ATCC 824 | strain=ATCC 824 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium acetobutylicum | true | Clostridium acetobutylicum ATCC 824 | Eubacteria | Firmicutes | 1 | 0.998 | 0.1 | 0.9 | 4,132,880 | 2 | 30.93 | 3,940,880 | 1 | 3,896 | 1,211,240 | 86.343567 | 100 | 0 | 0 | 345 | yes | yes | yes | 19 | high | 3,794,180 | TTTCTCCGTAGGCAGTTTCCTTTTGATACATAACCTTCAAATCTGAAATTTCATAATCCTTCATAACCTCCAAAGGTATATTTTCAAGAACCCAAGATACATACTTTACATTATTCACATGCCTATTAGTATCTATATCACTGTATCTTA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,222,050 | GAAATGGATCAGATGAGGACCTGCAGTCAACGAGCTTCCCGTCCAGGGGAGGAAACATCCGAACTGACCACCTGTCTTCGCACAAACAAGCATTTGGGGACCTTATGATGGAGGATGGTGACTTCTCGAGGAGGTCTGGGAGGGATTTCT | 11
|
G000009205 | ASM920v1 | GCF_000009205.1 | PRJNA57679 | SAMEA1705932 | null | 2006/09/20 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/205/GCF_000009205.1_ASM920v1 | 640,069,308 | RS_GCF_000009205.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,563 | 1,496 | Clostridioides difficile 630 | strain=630 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptostreptococcaceae | Clostridioides | Clostridioides difficile | true | Clostridioides difficile 630 ASM920v1 | Eubacteria | Firmicutes | 1 | 0.998 | 0.9 | 1 | 4,298,133 | 2 | 29.06 | 4,290,252 | 1 | 3,829 | 1,209,268 | 82.891874 | 99.51 | 0.37 | 0 | 340 | yes | yes | yes | 20 | high | 1,654,640 | AGTAAGACCACTTACTGATTGATTTCTAATAAATATTAATCCAGCACCTAAAAAACCTATACCACTGACAACTTGTGCTGCAACGCGGGCTGGGTCTAGACCAATACCTGGAGTACCCACTATATCATTAAATCCATACTTGGAAACAAT | 0no label
|
G000008765 | ASM876v1 | GCF_000008765.1 | PRJNA57677 | SAMN02603243 | null | 2002/11/22 | Genome Therapeutics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/765/GCF_000008765.1_ASM876v1 | 637,000,076 | RS_GCF_000008765.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,562 | 1,488 | Clostridium acetobutylicum ATCC 824 | strain=ATCC 824 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium acetobutylicum | true | Clostridium acetobutylicum ATCC 824 | Eubacteria | Firmicutes | 1 | 0.998 | 0.1 | 0.9 | 4,132,880 | 2 | 30.93 | 3,940,880 | 1 | 3,896 | 1,211,240 | 86.343567 | 100 | 0 | 0 | 345 | yes | yes | yes | 19 | high | 3,941,990 | TGATATCTTAGAAGCATGGTATTATATTTAATAAAGTGTAAGGAGCTTTTCTAATAAAAAAGGAACATTAGTTAAAAAATAATGAATACGTTTTATTACAAAAGCAAATTAGAATCGGTATAAATGGGTAAATACAAGATAATGGTGAGA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,283,250 | TTTTACCTCCCCAATATGTACTGGCCCATCCTGGCTCCCCCTGGGTCAGGCCAAACCCTGCTCCCACTCACAGGCCAGCACCCTGGAGCTAACCGTTCCAGAATAGAAGTGCGAGACTGGCCCAGGGTGTGAGGGGAGAAAGGGGCCATG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 305,400 | TACTCCCCCACACTCCCCCATACTCCCCCACACTCCCCCATACTCCCCCAACCTCCCCCATACTCCCCCACATTCCCCCATACTCCCCCATACTCCCCCAAACTCCCCCATACTCCTCCCCCATACTCCCCCACACTCCCCCACACTCCC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 893,550 | CCTCAGGGCCACACTGAACGCCTTCCTGTACCGCACGGGCCAGCACAGCAACAAGTGAGGGAGCCCCTCGGGTCCTGGGCCCCCGGGCAGGGCTGTGCAGCCGTCACCCTTGGTTCCCACCGAGGGACCTGAGGGGCCCTGGCTCACAGT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,404,850 | ATCATAAACGACATCCCACAGGGTCGCACCTTGGGGCTCCGTTATCCCTGCTCTGTTCTAATCCCAGATGTGCTCCCCCAAATCCATCTTGCCCTGTTCCCACCCTCCCATCCCTGCTGAGCGTGACACACACATGACCTTTGTGATATG | 11
|
G000009345 | ASM934v1 | GCF_000009345.1 | PRJNA57741 | SAMEA1705958 | null | 2007/01/12 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/345/GCF_000009345.1_ASM934v1 | 640,069,335 | RS_GCF_000009345.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 393,305 | 630 | Yersinia enterocolitica subsp. enterocolitica 8081 | strain=8081 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia enterocolitica | true | Yersinia enterocolitica subsp. enterocolitica 8081 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 4,683,620 | 2 | 47.22 | 4,615,899 | 1 | 4,253 | 1,352,606 | 85.086813 | 99.95 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 3,378,700 | TCAGCACATTGATTGAAGCAAAAAGTATTCTTGAGCAACAGGGCATACAGGTTGAGCAGGTTAATGGCCCTTCCGCCACCGGGGTTGAAAGCTTGCCGCAATTGGCTAAATGGGGAGTAACGCACGCCGAACCGGGTCACTCTTTAACCG | 0no label
|
G000009365 | ASM936v1 | GCF_000009365.1 | PRJNA224116 | SAMEA3138202 | null | 2006/07/24 | German Research Centre for Biotechnology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/365/GCF_000009365.1_ASM936v1 | 637,000,004 | RS_GCF_000009365.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 393,595 | 59,754 | Alcanivorax borkumensis SK2 | strain=SK2 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Oceanospirillales | Alcanivoracaceae | Alcanivorax | Alcanivorax borkumensis | true | Alcanivorax borkumensis SK2 | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,120,143 | 1 | 54.73 | 3,120,143 | 1 | 2,820 | 929,045 | 87.73194 | 100 | 0 | 0 | 352 | yes | yes | yes | 20 | high | 781,170 | TCTGTCGCTGGAGGCTTCCAGGTTTTGGTTAACGCTCAAGGTCAGTGAAAGTTGCTGCCACAGGCTTCGGCTATGGCCCAGTACTAGAAACCGGGTGTCGGGGCCGTTGAAAAGTCGGGTTTCTAGGTAGCTTACGTTCAGGTTTCCTTG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,404,600 | GCCCGGAGGGCTTCTTCCAAGCCCTTATTTCTAGGCTGGCGTGGGGCTGCCACTGAGAGTAGCACCAGGGCTAAAGATGTTCATCCACTCACTGCAGCTGCACTTCCCGGGTGCCTCCTACATGCCAGGCCTGCGCCAGGCTAAGGGATG | 11
|
G000006925 | ASM692v2 | GCF_000006925.2 | PRJNA62907 | SAMN02603599 | null | 2011/08/03 | Microbial Genome Center of ChMPH | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/925/GCF_000006925.2_ASM692v2 | 637,000,264 | RS_GCF_000006925.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 198,214 | 623 | Shigella flexneri 2a str. 301 | strain=301 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Enterobacteriaceae | Shigella | Shigella flexneri | true | Shigella flexneri 2a str. 301 | Eubacteria | Proteobacteria | 1 | 0.998 | 1 | 1 | 4,828,820 | 2 | 50.65 | 4,607,202 | 1 | 5,003 | 1,415,151 | 86.329724 | 99.7 | 0.21 | 0 | 372 | yes | yes | yes | 20 | high | 2,281,630 | TTGAATCCGCATAATTTAATGATTCATGTGAATATCCGGCGACATCAATATTCGCCGAACCTATAATTACGACATAATCCTTTTCGCGCATAGCACGTCCTCTGGTAAAAAATTACCAACCCTGTCAATCCACAAGAATATAGATACTGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,947,150 | CTGAAATCTCTAGAAAGCATCTAATTAATGCGTCTTCCCAAGTAGAATGTTTTAGTAATTGCTGTTCAAGCAACAGAAAAGTTGAGAAAGCTTTTATTACAAGTGCTGCAGGGACAGATAGAGATCCACACGGCTGCTTCTCGCAGGCAC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,761,100 | TTGTAGACCTGGTTCTCACAATGTGACATGGTTTTTTGACTTTCTGATGGCGTAAAAGTGATATGCATTTAGTAGAAATCTGTTTTTCACTTTCAGTGTAGTATTCAATGAATTACACAAGATATTCAACACTGTAAAATAGAGTTTGTG | 11
|
G000010565 | ASM1056v1 | GCA_000010565.1 | PRJDA19023 | SAMD00060921 | null | 2007/05/07 | Marine Biotechnology Institute Co., Ltd | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/010/565/GCA_000010565.1_ASM1056v1 | 640,427,128 | GB_GCA_000010565.1 | Monoisolate | Complete Genome | Full | na | Major | 370,438 | 110,500 | Pelotomaculum thermopropionicum SI | strain=SI | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptococcaceae | Pelotomaculum | Pelotomaculum thermopropionicum | true | Pelotomaculum thermopropionicum SI | Eubacteria | Firmicutes | 0.98 | 1 | 1 | 1 | 3,025,375 | 1 | 52.96 | 3,025,375 | 1 | 3,001 | 887,464 | 86.415667 | 100 | 0.63 | 0 | 331 | yes | yes | yes | 20 | high | 2,280,720 | TTGGCCGGGGTCAGGGTTATTTTGCTTGCCGCCGGTTTCACCAGGGCCGCCGGAGCGGTCTGCCGGGCCGCTACTTTTACGGTCAGGCTGTGTAACACCGGCGGGTTAGGCCCGGTAACGGTATGGAGGGTTTGCCGTACATAAAGGGTC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,383,000 | GTAAATAGCAGAGATTCAGTAAAGTTAATGCCAGTGTTTAACTATTAGTAGGACAGCCAATGATCATCTCGGTGACTCGGGAAGTTGGTTGGCAGTGCCTGATGACAGTGCTTGACGATCATCAGAAAGCTGCTTGGGATGAACTTTTAG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,883,350 | GTGACCGTGTGTACTCAGTGTCTGGCCCCCATTTATAAGCGAGAACATGCAGTATTGGTTTTCTGTTCAGGCATTAATTTGCTTAGGATTATGGCCTCCAGCTGCATCCACGTTGCTGCAAAGACCATGATTTCATTCCTCTTTTAAGGC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,694,350 | TTCTTGCTCTTCTTGCCTCTGTTCAGATACTCTCCCCAGGCGCTTTATGAGCCCTGTACTCAGGATATTGTGATGTTCCTTGTTGTGATGTTGTGCAACCAGAACTACATCCGAAACCCATATTTGGTGGCCAAACTGGTAGAAGTCATG | 11
|
G000008865 | ASM886v1 | GCF_000008865.1 | PRJNA57781 | SAMN01911278 | null | 2004/05/11 | GIRC | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/865/GCF_000008865.1_ASM886v1 | 637,000,108 | RS_GCF_000008865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 386,585 | 562 | Escherichia coli O157:H7 str. Sakai | strain=Sakai substr. RIMD 0509952 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Enterobacteriaceae | Escherichia | Escherichia coli | true | Escherichia coli O157:H7 str. Sakai Sakai substr. RIMD 0509952 | Eubacteria | Proteobacteria | 1 | 0.996 | 0.9 | 1 | 5,594,477 | 3 | 50.48 | 5,498,450 | 1 | 5,399 | 1,663,868 | 87.620737 | 99.97 | 0.33 | 0 | 374 | yes | yes | yes | 20 | high | 5,368,610 | GGTCAGGTATGGTTTGAGCAGCGCCAATATTGTGACTGTGGAGCGCCGGTATTTGAAGTTTTACGTTGCTCCGGGTGTGGTTCAGCTTATTTGTCTGCCAAAGAGGAGATGCGCGGTGATGGAACGAACTGGTTGGTAGCGCAACCAGCC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,506,150 | TTAGCCTAGTCCTTAATATTGAGTGAATGAGGAACGCAAATTGGAAGGGAGTCTATGTTGAGAAGAAAATTAAATGATATTTACTTTGAGTAGGGGAGGGGGAGGAAGTGTGGAGTTGGAGGAGTGGACAGTTGTCAGCTGAGATGCCCA | 11
|
G000007385 | ASM738v1 | GCF_000007385.1 | PRJNA224116 | SAMN02603680 | null | 2005/02/02 | NIAB, Rural Development Administration | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/385/GCF_000007385.1_ASM738v1 | 637,000,346 | GB_GCA_000007385.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 291,331 | 347 | Xanthomonas oryzae pv. oryzae KACC 10331 | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas oryzae | true | Xanthomonas oryzae pv. oryzae KACC 10331 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,941,439 | 1 | 63.69 | 4,941,439 | 1 | 4,831 | 1,427,680 | 85.113992 | 99.82 | 0 | 0 | 355 | yes | yes | yes | 20 | high | 1,266,330 | CGCTGCGGTCATCAGCTGGCCGACGAAGATGCCCAGGGCGATTTCCCACCAAAGCCCATCTTGGTTGTTCTGCGGTCTGTAGCTCATACGGTCCCCAATGACGATGCTCCGGGATTGTAGGGGTGTAGGGGCATCGCCCCTACGGATAAC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,176,950 | CACCCAGGTGAGCATCTCACAGCCTGGAGCAGCACCCACACACCCAGGTGAGCATCTGACAGCCTGGAACAGCACGCTGCACCCCCAGGTGAGTATCTGACAGCCTGGAACAGCACGCACATCCCCAGACGAGCAACTGACAGCCTGGAA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,544,350 | CCTGACTATGGTGGCTCCATCCCTTGCCATCCCTTTCCTGCTTCCGTGTTCTTATTTTGAGGCACTTGCCACTTCTTGCACTTCATTTTGTCTTTAGTTGTTTTACTGCCTCTATCTCCTAGAATGTCAGCTTCATGAGGGCAGGACTCA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,324,900 | TTTGATTGATACCCAGTCTTACTCTTGAGATCACTTTTTTTTCTGAGACAGTCTTGCTTTGTCACCCAGACTGGAGTGTAGTGGCGTGATCTTGTGTCACTGCAGCCTCCACTTCTCGGGCCTAAGCAGTCCTCCTGCCTCAGTCCCCCA | 11
|
G000007765 | ASM776v1 | GCF_000007765.1 | PRJNA57631 | SAMN02603970 | null | 2005/07/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/765/GCF_000007765.1_ASM776v1 | 637,000,086 | RS_GCF_000007765.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 227,377 | 777 | Coxiella burnetii RSA 493 | strain=RSA 493 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Legionellales | Coxiellaceae | Coxiella | Coxiella burnetii | true | Coxiella burnetii RSA 493 ASM776v1 | Eubacteria | Proteobacteria | 1 | 0.995 | 0.9 | 1 | 2,032,674 | 2 | 42.6 | 1,995,281 | 1 | 2,058 | 613,036 | 88.849515 | 100 | 0 | 0 | 308 | yes | yes | yes | 20 | high | 340,340 | AAAGTGTGCAAGTGGTAACGCCGCCTGTTTCGGGGGCTAGCTGTTTGCTCAGCAACGATAAAGGAAAATGGTATTTAAAATCTACGCCTGGGTACGTGACTGTGCATCGTGCCTACGCTCCTCTAGCCGTTAGTTGCCATAAAAAAGGTT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,382,950 | AGTTTGTCCTCATAGGGCTATAAAGAAATACCCAAGACTGGGTGATTTATAAAGAAAAGAGGTTTAATTTGTTCATGGTTCCACAGGCGGTTCAGGAAGCATGGTGCCGGCATCTGCTTGGATTCTGGGGGAGGCCTCAGGAAACTTACA | 11
|
G000006985 | ASM698v1 | GCF_000006985.1 | PRJNA57897 | SAMN02604006 | null | 2002/07/02 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/985/GCF_000006985.1_ASM698v1 | 637,000,073 | RS_GCF_000006985.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 194,439 | 1,097 | Chlorobium tepidum TLS | strain=TLS | null | Bacteria | Chlorobi | Chlorobia | Chlorobiales | Chlorobiaceae | Chlorobaculum | Chlorobaculum tepidum | true | Chlorobium tepidum TLS | Eubacteria | FCB | 1 | 1 | 0.8 | 1 | 2,154,946 | 1 | 56.53 | 2,154,946 | 1 | 2,009 | 639,065 | 87.375415 | 98.9 | 0.55 | 0 | 334 | yes | yes | yes | 20 | high | 1,238,900 | AGCGAAATCCTCCCGGTTTTGTTATTTCAACCTGAAGCGCTATATACTCAAGGTTTATCCTTACGGGAACTTCACCCTTTGACCCACAACAGCATATGCGGCTCTCGAACTTTCGATACACCCTTCCCAAAACACGAATCGCCGATCACC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,714,900 | AAAGTTCTTACTAATTTCAAAGGGGGAATTACAATTTTACATTGAAGAAATATAGCAGACACTACCTGAATCAAGTGATCAAAAGTAACATCGTGAAATCGGGACAAACACACAGCTGTGGCTCTGGTTTGAAGAATGAAGGACCTGACA | 11
|
G000010505 | ASM1050v1 | GCF_000010505.1 | PRJNA224116 | SAMD00060922 | null | 2008/05/20 | Kitasato University | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/505/GCF_000010505.1_ASM1050v1 | 642,555,148 | RS_GCF_000010505.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 431,947 | 837 | Porphyromonas gingivalis ATCC 33277 | strain=ATCC 33277 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Porphyromonadaceae | Porphyromonas | Porphyromonas gingivalis | true | Porphyromonas gingivalis ATCC 33277 | Eubacteria | Bacteroidetes | 1 | 1 | 0.9 | 1 | 2,354,886 | 1 | 48.36 | 2,354,886 | 1 | 1,981 | 685,765 | 85.805173 | 99.92 | 0 | 0 | 278 | yes | yes | yes | 20 | high | 2,249,130 | CTTCAGAACTATGATGACCTCTATGCCGATGTGCTACTGTGGCAAAAAAGAGGATGGATCGACTATGTTATCCCCCAAATCTATTGGGAGATCGGACACAAAGCCGCGGACTATGCCACGTTAGCTGAGTGGTGGGGGCGCAATTCTGTA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,281,350 | GAGTAGCTAGGATTACAGGTGCATGCCACCACACCCAGCTAATTTTTGTATTTATTTTAGTAGAGATGGGGTTTCACCATGTTGGCTAGCCTGGTCTCGAACTCCTGACCTCAAGTGATCCGCCCACCTCAGCCTCCCAAAGTGCTGGGA | 11
|
G000010185 | ASM1018v1 | GCF_000010185.1 | PRJNA224116 | SAMD00060918 | null | 2008/02/14 | Kitasato Institute for Life Sciences | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/185/GCF_000010185.1_ASM1018v1 | 641,522,627 | RS_GCF_000010185.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 334,413 | 1,260 | Finegoldia magna ATCC 29328 | strain=ATCC 29328 | null | Bacteria | Firmicutes | Tissierellia | Tissierellales | Peptoniphilaceae | Finegoldia | Finegoldia magna | true | Finegoldia magna ATCC 29328 | Eubacteria | Firmicutes | 1 | 0.995 | 1 | 1 | 1,986,740 | 2 | 32.07 | 1,797,577 | 1 | 1,846 | 611,719 | 90.720879 | 99.39 | 0 | 0 | 282 | yes | yes | yes | 20 | high | 983,190 | GTAAGTGCCAATCTATTTGATTTGTCTATATACAAATACACCAAATATTTTTGACCTTTTACTAATTTTGAAGTTTGTTCCTTAAAAGGCAACAAAATATCCTTATCCAACCCGCAATCCAAGAATGCGCCTATTCTAGTAATATCTTTA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,836,600 | TTGTTGATCCAGTCTGTCTTGCAGGAAGTGGTCTCTAGTAATCAATTTTCAGCTAAACGCCAAATGTCAGAAAGATCTCAGTGACTGTCTTTAACGAACAGGGTTGTTTATGATTCACCCGGAGTCGCCTCGCCAGGCTTCTCAGTATAC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,394,500 | ATACTAAGGGTTTTAAATATGTAGCATTTATGTGTTTATTATGTATTTCTATATTCATAAACATTGAGGATTCTTTTATTGTCTCATGTAACAAGAAGACAAGCAGCTCAGGGATGGCGGCTCCCGTGTGCTTCTCCATGATCTCTCAGC | 11
|
G000011065 | ASM1106v1 | GCF_000011065.1 | PRJNA62913 | SAMN02604314 | null | 2003/03/28 | Washington University Department of Molecular Biology and Pharmacology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/011/065/GCF_000011065.1_ASM1106v1 | 637,000,026 | RS_GCF_000011065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,186 | 818 | Bacteroides thetaiotaomicron VPI-5482 | strain=VPI-5482 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Bacteroidaceae | Bacteroides | Bacteroides thetaiotaomicron | true | Bacteroides thetaiotaomicron VPI-5482 | Eubacteria | Bacteroidetes | 1 | 0.998 | 0.7 | 1 | 6,293,399 | 2 | 42.86 | 6,260,361 | 1 | 4,944 | 1,919,297 | 89.876027 | 99.41 | 0.4 | 0 | 348 | yes | yes | yes | 20 | high | 4,712,760 | TTGAAGAAACCTTGCAAATTGTGTTCTCCCTCGATGGCATCGCGGATGGCGGAGTTTTCTTTATAGGCAAGGGCTATGTACTCAAACAGAGGGCGCCATTGTCCGTCGAAGGCCATGTCGTCAATTAAATCTTTTAAGTGAGGCAAGAAT | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,596,250 | GAGCTGAGGACACCCAGGTCCATGTTACAGGTGAAGAGTTTTTGCATGGCCAGTGATGCTTCTGTGAGTTTCATTGAAGACTTGAAAAGCTACATGTGGTCAGCCCCAATGGCGTGCCCACCTAGCATGTGCATCCTGATGGGGCTCTGG | 11
|
G000008565 | ASM856v1 | GCF_000008565.1 | PRJNA57665 | SAMN02603976 | null | 2000/12/11 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/565/GCF_000008565.1_ASM856v1 | 637,000,092 | RS_GCF_000008565.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,230 | 1,299 | Deinococcus radiodurans R1 | strain=R1 | null | Bacteria | Deinococcus-Thermus | Deinococci | Deinococcales | Deinococcaceae | Deinococcus | Deinococcus radiodurans | true | Deinococcus radiodurans R1 ASM856v1 | Eubacteria | Terrabacteria | 1 | 0.991 | 0.8 | 1 | 3,284,156 | 4 | 66.61 | 2,648,638 | 1 | 3,248 | 987,980 | 88.625967 | 98.72 | 0 | 0 | 359 | yes | yes | yes | 20 | high | 2,084,160 | GGTGCGCGTCACCTCGGGGTCTTTTTGCCGCAGCGCTCCCGCCGCGCCGTTGCGGGGGTTTTTCAGCAGCGGCGTGCCGAGTTCTTCGGCCTGCGCATTGAAGGCGGCGAAGTCGGCGCGCGACAAGTAGACCTCGCCGCGCACTTCGAG | 0no label
|
G000009065 | ASM906v1 | GCF_000009065.1 | PRJNA57621 | SAMEA1705942 | null | 2003/05/06 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/065/GCF_000009065.1_ASM906v1 | 637,000,351 | RS_GCF_000009065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 214,092 | 632 | Yersinia pestis CO92 | strain=CO92 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia pestis | true | Yersinia pestis CO92 ASM906v1 | Eubacteria | Proteobacteria | 1 | 0.994 | 1 | 1 | 4,829,855 | 4 | 47.64 | 4,653,728 | 1 | 4,298 | 1,371,586 | 83.669593 | 99.82 | 0 | 0 | 372 | yes | yes | yes | 20 | high | 2,316,470 | ATTATTTTGTTGCTTAGTAATGCTGTTTTAGCAACAGAGAATAATAAAAATAGATTAAATGATAATGTGGTATCACACGCTGACATAGATGTGCGTAATGAATATAACGAGGAAGGCAATAGAGTAGGAAAACGTTTTTTTTCTACAAAC | 0no label
|
G000009305 | ASM930v1 | GCF_000009305.1 | PRJNA224116 | SAMEA3138199 | null | 2006/06/28 | Penn State Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/305/GCF_000009305.1_ASM930v1 | 637,000,130 | RS_GCF_000009305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 382,638 | 212 | Helicobacter acinonychis str. Sheeba | strain=Sheeba | null | Bacteria | Proteobacteria | Epsilonproteobacteria | Campylobacterales | Helicobacteraceae | Helicobacter | Helicobacter acinonychis | true | Helicobacter acinonychis str. Sheeba | Eubacteria | Proteobacteria | 1 | 0.994 | 0.9 | 1 | 1,557,588 | 2 | 38.17 | 1,553,927 | 1 | 1,547 | 470,618 | 89.011857 | 99.12 | 0.7 | 100 | 271 | yes | yes | yes | 20 | high | 710,320 | AATTACATGCCTGAACTCATTTATGTTTATCCTATTAATTTTGAACCTTTTGGGGGTAAAATAGGGAATTTTTCTGAAATTTGGGCAGGTTGGCAGCACATTTCTAATGGCGTGGGGGGTGCGGAATGTTATCAGCCTTTCAATAAAGAG | 0no label
|
G000008165 | ASM816v1 | GCF_000008165.1 | PRJNA58091 | SAMN02598266 | null | 2004/06/24 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/165/GCF_000008165.1_ASM816v1 | 637,000,015 | RS_GCF_000008165.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 260,799 | 1,392 | Bacillus anthracis str. Sterne | strain=Sterne | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Bacillus anthracis str. Sterne ASM816v1 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,228,663 | 1 | 35.38 | 5,228,663 | 1 | 5,471 | 1,495,624 | 84.251844 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 207,220 | ATTAAATGAGAAGTTTGAGGGGCTTAAGGAAGCTTTACAATCAAATCAAAAGTAAGAAAAGACGACCGGGCATAGACGGTCGTCTTTTCTATTACTATTTATAATAAAGGGGAAAGGGGACACAAAAGTTATATAAGCGTAGTGGCGTAA | 0no label
|
G000007945 | ASM794v1 | GCF_000007945.1 | PRJNA224116 | SAMN02604087 | null | 2003/07/23 | Univ. Ohio | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/945/GCF_000007945.1_ASM794v1 | 637,000,124 | RS_GCF_000007945.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 233,412 | 730 | Haemophilus ducreyi 35000HP | strain=35000HP | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pasteurellales | Pasteurellaceae | Haemophilus | [Haemophilus] ducreyi | true | Haemophilus ducreyi 35000HP | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 1,698,955 | 1 | 38.22 | 1,698,955 | 1 | 1,689 | 506,660 | 87.856241 | 99.43 | 0.02 | 0 | 277 | yes | yes | yes | 20 | high | 1,350,440 | CCGCTTAGTAACGCAAAAAGCCTCCATAAATGAGGCTTTATATTTAATGGCGATTACTCACTAAACTGCATACTATACAGTTGTTTATAAGCACCGCCTTTCGCTAATAATTGTTCATGTGAACCACGTTCAACAATCTTACCTTGATCG | 0no label
|
G000008665 | ASM866v1 | GCF_000008665.1 | PRJNA224116 | SAMN02603985 | null | 1999/12/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/665/GCF_000008665.1_ASM866v1 | 638,154,502 | RS_GCF_000008665.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 224,325 | 2,234 | Archaeoglobus fulgidus DSM 4304 | strain=DSM 4304 | null | Archaea | Euryarchaeota | Archaeoglobi | Archaeoglobales | Archaeoglobaceae | Archaeoglobus | Archaeoglobus fulgidus | true | Archaeoglobus fulgidus DSM 4304 | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 0.9 | 2,178,400 | 1 | 48.58 | 2,178,400 | 1 | 2,518 | 688,447 | 93.086761 | 100 | 0 | 0 | 186 | no | yes | yes | 17 | medium | 1,177,280 | GAAGAACGAGCATAATTCCGTCCACACCCGTATCTATAGCATTATCTACTTGAGATTTGATAGAGTCAAAGTGTGGGGAATCGTAGATAAACTCAGAAATGTTTATATTATGAATATGCCACACCTCATCAATTTTAGAACTTATTTGTG | 0no label
|
G000008885 | ASM888v1 | GCF_000008885.1 | PRJNA224116 | SAMD00061100 | null | 2004/05/11 | Yale Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/885/GCF_000008885.1_ASM888v1 | 637,000,338 | RS_GCF_000008885.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 36,870 | 51,229 | Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Erwiniaceae | Wigglesworthia | Wigglesworthia glossinidia | true | Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis | Eubacteria | Proteobacteria | 0.99 | 0.986 | 1 | 1 | 703,004 | 2 | 22.48 | 697,724 | 1 | 646 | 209,912 | 87.974606 | 100 | 0 | 0 | 207 | yes | yes | yes | 20 | high | 506,610 | ACTTTTTTTAAAATAATTATGATAATTTAATATAAATTAAATTTTAATACACAATAATATTAAAGAACTATAGTAGAGTCAAATTAGAAAAATAAAATTTAATAAATTAAATTAATTTAAAAAATTAATTTTTAAAATAAATTAATTTTA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,214,600 | AAACTGAAACCATTCAGAAATAAAACAAACGGGGCAGGGGGCAGGAGAGAAACGGCCAACAATAAGCTACTATTCTCCTACCACTTTCTCACTGGTGCAGGCATCTCCAAACCAAACCACTCAGAAATTTTATATACAAGGAATAAATCA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,402,100 | GAGAACTGGCTCAAAGTAATCCAATAAAAATCAGTATTACTTTTTAATTTTTTAATTTTTATTTTTTAAGACAGAGTCTCATTCTGTTGCCAAGGCAGGAATGCAGTGTCACGATCTCAGCTCACTGCAACCTCCACCTCGTGGGCTCAA | 11
|
G000010065 | ASM1006v1 | GCF_000010065.1 | PRJNA224116 | SAMD00061073 | null | 2004/12/16 | Nagoya University, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/065/GCF_000010065.1_ASM1006v1 | 637,000,307 | RS_GCF_000010065.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 269,084 | 32,046 | Synechococcus elongatus PCC 6301 | strain=PCC 6301 | null | Bacteria | Cyanobacteria | null | Synechococcales | Synechococcaceae | Synechococcus | Synechococcus elongatus | true | Synechococcus elongatus PCC 6301 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 2,696,255 | 1 | 55.48 | 2,696,255 | 1 | 2,691 | 815,460 | 89.10092 | 99.73 | 0 | 0 | 342 | yes | yes | yes | 20 | high | 1,707,290 | AGTTGCTCGATAGCATTGGCGCTGACAGCGTCTTGCAGGCTGCCGATCGCGGCTTCGGTATCCGCTTGCAGAAAGTCCGCCAGAAAGGATCGAGTGGTTGCTGGATCAAGCGGTCGATGACAGAAGCGACTGAGAATCAGGCGATCGAGG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,721,750 | ATTAACCATAGATGGGGCACAGAGTGATTAGGTCAGAAATCTTGAATTCTGCATCTCAAGATTCATAAATGACTTAAGTTTTCTATCCTAAGGAGGCTTCCAGAAGGAAAGACAATCACACAAACAGATGAGTGGGCTGAGGGAATGGCT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,034,650 | GTCTTGCTCTGTTACCCGGGCTGGAGTGCAGTGGCACAATCTCAGCTCACTGCAACTTCTACCTCCCAGGTTCAAGCAATTCTTGAGTCTCAACTTCCCAAGAAGCTGGAATTACAGGCATGCGCCATCACGCCTAGCTAAATTTTGTAT | 11
|
G000005825 | ASM582v2 | GCF_000005825.2 | PRJNA224116 | SAMN02603086 | null | 2010/12/15 | Center for Genomic Sciences, Allegheny-Singer Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/005/825/GCF_000005825.2_ASM582v2 | 646,311,908 | RS_GCF_000005825.2 | Monoisolate | Complete Genome | Full | representative genome | Major | 398,511 | 79,885 | Bacillus pseudofirmus OF4 | strain=OF4 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus pseudofirmus | true | Bacillus pseudofirmus OF4 | Eubacteria | Firmicutes | 1 | 0.995 | 1 | 1 | 4,249,248 | 3 | 39.86 | 3,858,997 | 1 | 4,260 | 1,228,222 | 85.144124 | 98.68 | 1.32 | 0 | 377 | yes | yes | yes | 20 | high | 3,882,060 | TGGCGACAGGAATTGATTATCTCGTTATCTTAATCCTCTTGTTTTCGCAAATAAAAAAAGGTGAGGTAAAACATATTTGGATAGGACAATATATAGGAACTGCGATTATTATAGGAGTAAGTCTTTTTGTTGCTCTAGGGGTTGCAAATT | 0no label
|
G000009345 | ASM934v1 | GCF_000009345.1 | PRJNA57741 | SAMEA1705958 | null | 2007/01/12 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/345/GCF_000009345.1_ASM934v1 | 640,069,335 | RS_GCF_000009345.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 393,305 | 630 | Yersinia enterocolitica subsp. enterocolitica 8081 | strain=8081 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia enterocolitica | true | Yersinia enterocolitica subsp. enterocolitica 8081 | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 4,683,620 | 2 | 47.22 | 4,615,899 | 1 | 4,253 | 1,352,606 | 85.086813 | 99.95 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 4,631,770 | GCGGGTGGTGCTAACTGAAAGTGCGAGACGAAATAACGTGGTAACGAGTAGCACCGCTGGGAAAGCTGAAAATTGTAAAGGAGAGTTGATATAGATCGCTATCATTAACAACACCACTGAAATGGTCATGTTAACAGCAATCAGAATGTC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,856,850 | AGGTATAAAATTATGAGGTGTCTCTACAGGTGACTGGAATCTGACAGCATGGTGTGTACTAGGTTGGATGGTGTCCCACCAAACTTATGTCCCTCCTGGAACCCAAACTCTGACCTTATTTGGAAACATGGTCACTGCAGATTTAATCAG | 11
|
G000008165 | ASM816v1 | GCF_000008165.1 | PRJNA58091 | SAMN02598266 | null | 2004/06/24 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/165/GCF_000008165.1_ASM816v1 | 637,000,015 | RS_GCF_000008165.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 260,799 | 1,392 | Bacillus anthracis str. Sterne | strain=Sterne | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Bacillus anthracis str. Sterne ASM816v1 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,228,663 | 1 | 35.38 | 5,228,663 | 1 | 5,471 | 1,495,624 | 84.251844 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 4,948,970 | AGCTGACAAACTACCTCCATTCATGAGATTAATCTCGTTATTCTTCGTCATGATTGGTGCCACGGCATCCGCCGTGCTTATTACATCAGCAAATACATGGATGAATACACCCGCGGGCTTCTCAATGGGGCCAGATGGATCAGTTTTTAA | 0no label
|
G000007105 | ASM710v1 | GCF_000007105.1 | PRJNA224116 | SAMN02603579 | null | 2010/01/12 | Macrogen Inc. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/105/GCF_000007105.1_ASM710v1 | 637,000,356 | RS_GCF_000007105.1 | Monoisolate | Complete Genome | Full | na | Major | 264,203 | 542 | Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 | strain=ZM4 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Sphingomonadales | Sphingomonadaceae | Zymomonas | Zymomonas mobilis | true | Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 ZM4 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 2,056,363 | 1 | 46.33 | 2,056,363 | 1 | 1,753 | 604,103 | 86.562441 | 100 | 0 | 0 | 320 | yes | yes | yes | 20 | high | 1,314,300 | ATTCGTCAAGCATACGGATATTACACGGAGATACGGTTTTAAATCGTCTACCGAATGGATTAGATGTTGCTGCCGCTCATCCAGAAAAAGATGATTACTGTTGGGCAGCTATCAATCATACTAATAATCAAATTAATAATTTTGAATTGA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,751,800 | GTGGTTTAATTTATATTTTCCTGACTAATGAATATGATCAACTGTATTATATTTATTTGCCATGTGTGTCTGCCTCATGTTGAAGTGCCTCTTCAAAGCTTTTGTCAATTTTCTATAAAATTGCCTTTTTCTTGCTCATGTTTAGGGGTT | 11
|
G000007265 | ASM726v1 | GCF_000007265.1 | PRJNA57943 | SAMN02604013 | null | 2002/08/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/265/GCF_000007265.1_ASM726v1 | 637,000,285 | RS_GCF_000007265.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 208,435 | 1,311 | Streptococcus agalactiae 2603V/R | strain=2603V/R | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus agalactiae | true | Streptococcus agalactiae 2603V/R | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,160,267 | 1 | 35.65 | 2,160,267 | 1 | 2,106 | 643,747 | 87.791509 | 100 | 0.18 | 0 | 298 | yes | yes | yes | 20 | high | 924,040 | AACTTGACGTTCGCCACTTTTGGTCTTTGGTGTTTCAATGTAGTACCCAATTTCAGTATCTCTCAATAGCTGATGGTCTATATTGACAAGACGATTCTCAAAATCTAAATCTGGAAGTGTCAAACCACCAAACTCTGAAATACGAAGACC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 383,400 | CAAGCCCAGGAGTTTGAGACCAGCCTGAACAACACAGTGAGACCCCGTCTCTACAAAAATATACAAAATATTATCCAGGCCTGGTGGCGGAGTCCCAGTTACTTGGGAGGCTAAGGTGAGAGAATCACTTGAATCCAGAAGGTACGTGTC | 11
|
G000010625 | ASM1062v1 | GCF_000010625.1 | PRJNA224116 | SAMD00060936 | null | 2008/01/24 | Kazusa DNA Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/625/GCF_000010625.1_ASM1062v1 | 641,522,640 | RS_GCF_000010625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 449,447 | 1,126 | Microcystis aeruginosa NIES-843 | strain=NIES-843 | null | Bacteria | Cyanobacteria | null | Chroococcales | Microcystaceae | Microcystis | Microcystis aeruginosa | true | Microcystis aeruginosa NIES-843 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 5,842,795 | 1 | 42.33 | 5,842,795 | 1 | 5,605 | 1,591,543 | 80.239081 | 99.89 | 0.51 | 25 | 350 | yes | yes | yes | 20 | high | 5,322,460 | GTTTTAGAATTGGTGCAGCAAAGTGGTCATCATATTGCCTTGGTAGTGGATGAGTACGGGGTAATTCAAGGATTGGTGACGCGCAAGGATATTTTAGAGGCAATTGTCGGCGATTTACCCCAATTAGATAACATTGAAGATGCTCAGATC | 0no label
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Pseudomonas putida KT2440 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 5,795,140 | TACTCCGGGGTCACACCAAAACGGCCGGTGGCCACCTGCTTGATCTTCGAGCTCTTGATGGTGCCATAGCGCGACGGGTCTTCGCCGCCTTCACCCGAGTTGGAGCGTGCGCCCAGGCGGTTCATGGCCTCGGCCAGCGCTTCGTGGGCT | 0no label
|
G000010425 | ASM1042v1 | GCF_000010425.1 | PRJNA224116 | SAMD00061080 | null | 2006/12/05 | Gifu University, Life Science Research Center, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/425/GCF_000010425.1_ASM1042v1 | 639,633,010 | RS_GCF_000010425.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 367,928 | 1,680 | Bifidobacterium adolescentis ATCC 15703 | strain=ATCC 15703 | null | Bacteria | Actinobacteria | Actinobacteria | Bifidobacteriales | Bifidobacteriaceae | Bifidobacterium | Bifidobacterium adolescentis | true | Bifidobacterium adolescentis ATCC 15703 | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 2,089,645 | 1 | 59.18 | 2,089,645 | 1 | 1,683 | 614,966 | 86.722338 | 100 | 0 | 0 | 284 | yes | yes | yes | 20 | high | 810,030 | CGTCTCCATCGAGGATCCGTTCCAGGAAGAAGGCTGGGACGACTGGGCGGCCATCACCGCCAAGCTCGGCGATCGCCTGCAGTTCGTCGGCGACGACCTGCTGGTCACCAACCCGGCACGTCTGGCCAAGGGCATCAAGCTCGGCGCCGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,394,100 | TGTATTGTATTGTATTGTATTGTATTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATTTGAGACGAAGTTTTGCTCTTGTTGCCCAGGCTGGAGTCCAA | 11
|
G000007385 | ASM738v1 | GCF_000007385.1 | PRJNA224116 | SAMN02603680 | null | 2005/02/02 | NIAB, Rural Development Administration | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/385/GCF_000007385.1_ASM738v1 | 637,000,346 | GB_GCA_000007385.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 291,331 | 347 | Xanthomonas oryzae pv. oryzae KACC 10331 | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas oryzae | true | Xanthomonas oryzae pv. oryzae KACC 10331 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,941,439 | 1 | 63.69 | 4,941,439 | 1 | 4,831 | 1,427,680 | 85.113992 | 99.82 | 0 | 0 | 355 | yes | yes | yes | 20 | high | 2,453,360 | CGATGTGCGACGGCGTGACCCAGGGCCGCGCCGGCATGGAATTGTCGCTGTTCTCGCGCGACAACATCGCTCAGGCCGCGGCTATCGGTCTGAGCCACGACATGTTCGACAGCGTGGTGTACCTGGGCGTATGCGACAAGATCGTGCCGG | 0no label
|
G000008885 | ASM888v1 | GCF_000008885.1 | PRJNA224116 | SAMD00061100 | null | 2004/05/11 | Yale Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/885/GCF_000008885.1_ASM888v1 | 637,000,338 | RS_GCF_000008885.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 36,870 | 51,229 | Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Erwiniaceae | Wigglesworthia | Wigglesworthia glossinidia | true | Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis | Eubacteria | Proteobacteria | 0.99 | 0.986 | 1 | 1 | 703,004 | 2 | 22.48 | 697,724 | 1 | 646 | 209,912 | 87.974606 | 100 | 0 | 0 | 207 | yes | yes | yes | 20 | high | 228,020 | ATATTATTTTTTATAAATAAAATATTATTTTTTTTTAAATTATTTTAAAATGTTATAAAAATTAAATTTTTAAAAAAATTTTTTTAAATTAAAAATAGTATTTTATTTTTCTATATGATATTTTTAAAATTTTAATTACTTATATTTAAA | 0no label
|
G000008765 | ASM876v1 | GCF_000008765.1 | PRJNA57677 | SAMN02603243 | null | 2002/11/22 | Genome Therapeutics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/765/GCF_000008765.1_ASM876v1 | 637,000,076 | RS_GCF_000008765.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,562 | 1,488 | Clostridium acetobutylicum ATCC 824 | strain=ATCC 824 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium acetobutylicum | true | Clostridium acetobutylicum ATCC 824 | Eubacteria | Firmicutes | 1 | 0.998 | 0.1 | 0.9 | 4,132,880 | 2 | 30.93 | 3,940,880 | 1 | 3,896 | 1,211,240 | 86.343567 | 100 | 0 | 0 | 345 | yes | yes | yes | 19 | high | 2,774,460 | AAGCTTCTGCTACTTTACCTTGATTTAATACTTCATCTATGGCAACTTCCATTCCCTTTACCCAATTCAATGAATCAAATATTCTAAATACATCTATTCCTGATTTGCTAGATTGTTTTATAAACTCTCTTATAACATTATCAGGATAGT | 0no label
|
G000007825 | ASM782v1 | GCF_000007825.1 | PRJNA57975 | SAMN02603340 | null | 2004/07/06 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/825/GCF_000007825.1_ASM782v1 | 637,000,017 | RS_GCF_000007825.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,900 | 1,396 | Bacillus cereus ATCC 14579 | strain=ATCC 14579 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus cereus | true | Bacillus cereus ATCC 14579 | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,427,083 | 2 | 35.29 | 5,411,809 | 1 | 5,541 | 1,546,426 | 83.933929 | 98.18 | 0.58 | 18.18 | 383 | yes | yes | yes | 20 | high | 4,379,180 | CTAACTATTTTTTCCGTTCTACAATTTCTTTTTTACTTCCAAAACGAACGATAGCATACTTTTCGATAATATCATCTTTGAAATAAATTTCAAATGGAATATTTTTTTGTAATCCTTTTTGCAAAAACTGTTTTTGCAGTTCTTTAGGCG | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,001,250 | ACCTCCTCATGTGCCCCTTTCTCCTGGTCCTCCACCTTCCGTCCTTCTCTGCATTCTCCGCCTGCCCCCGCAGGGGACCAGGCCCCCATTCCAGGCCAGACTTCCCTGCAGATTCTGTATGGCTCATTTGGAAACTATTTCTGCTTCTAA | 11
|
G000010585 | ASM1058v1 | GCF_000010585.1 | PRJNA224116 | SAMD00060930 | null | 2009/01/28 | Juntendo University School of Medicine | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/585/GCF_000010585.1_ASM1058v1 | 643,348,562 | RS_GCF_000010585.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 458,233 | 69,966 | Macrococcus caseolyticus JCSC5402 | strain=JCSC5402 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Macrococcus | Macrococcus caseolyticus | true | Macrococcus caseolyticus JCSC5402 | Eubacteria | Firmicutes | 1 | 0.965 | 1 | 1 | 2,219,737 | 9 | 36.56 | 2,102,324 | 1 | 2,352 | 677,409 | 89.896055 | 96.13 | 1.1 | 0 | 339 | yes | yes | yes | 20 | high | 1,850,680 | CAATGAGTATGGAGTTCTTCACATATAAATGGATGGATCTCTTCTTTAACAACCCAGATAAGTTCAAATATAAACATATCGGGGATGCCATCAAGTTCTTACCTTATGGTGTGACAGTTGATGAATTTCAGCATATCGTCTATGAACATC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,119,550 | AGCGCCAGGCCTCCCCGTGTGCAGGTCGTGCCGAGCAGCGCTTCCTACGTTCTCTCTCAGAATCTCTGCAGTGGCCCTCTGGGCTGAGCAGTGCTGTTCTCCCCATGTTACAGATGGGAAAACTGAGGCTTGCATGGCTGACAGTGGCAG | 11
|
G000007825 | ASM782v1 | GCF_000007825.1 | PRJNA57975 | SAMN02603340 | null | 2004/07/06 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/825/GCF_000007825.1_ASM782v1 | 637,000,017 | RS_GCF_000007825.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,900 | 1,396 | Bacillus cereus ATCC 14579 | strain=ATCC 14579 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus cereus | true | Bacillus cereus ATCC 14579 | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,427,083 | 2 | 35.29 | 5,411,809 | 1 | 5,541 | 1,546,426 | 83.933929 | 98.18 | 0.58 | 18.18 | 383 | yes | yes | yes | 20 | high | 5,239,260 | GCCTTCCATGAAAAAGAAACCTTCTTTTTCTGCTCGAGCTTTCAAAATAGAAAAAATCAGCTCTTTTTTCGTTAACTTGCTATAATACGAAATCTTAAATTCTTTCGCAAGCTCGTATAACTCTTTTAATTTCATGTTTTCTAATGCTGC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,353,700 | TGAGACGGAGTCTCGCTCTTGTCGCCCAGGCTGGAGTGCAGTGGTGCGATCTTGGCTCGCTGCAAGCTCCGCCTCACGCCATTCTCCCGCCTCAGCCTTCTGAGTAGCTGGGACTACAGGTGCCCGCCACCACGCCCGGCTAATTTTTTG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,775,050 | GCTGTCTCACACCATCAGCCTTCGTTCAGCTTCCCCAGAAGGAGATCCCGAGATGAAGACTTGAGTGTGAACAGTTTATCTGAGAAGCCATCCCAGGAAACACCAGTCAGGGCATGTGGAAGTGAAAGAGGAGGAGGAGGAATGCAAATG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,812,800 | CTCCGCAGTCCAGGGCAGGCCTCAAAGGTGGCTGTAGCCGCATGTAATCAATGAGGGTCAAGCTTCATCACTCACACTCGAGGCCCTGACGGGGCGGATGCCAGGTGGGGTTTAGGCCAGGTCGCTGGGGACACCAAAGCATGGGCTCAG | 11
|
G000009865 | ASM986v1 | GCF_000009865.1 | PRJNA224116 | SAMD00061066 | null | 2005/06/30 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/865/GCF_000009865.1_ASM986v1 | 642,555,160 | RS_GCF_000009865.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 279,808 | 1,283 | Staphylococcus haemolyticus JCSC1435 | null | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus haemolyticus | true | Staphylococcus haemolyticus JCSC1435 | Eubacteria | Firmicutes | 1 | 0.989 | 1 | 1 | 2,697,861 | 4 | 32.78 | 2,685,015 | 1 | 2,600 | 785,925 | 85.820989 | 99.62 | 0 | 0 | 341 | yes | yes | yes | 20 | high | 142,610 | GTAATATATTGCAATTGTTTATGTATGGATTTGCCATATAAATTCATCTCGCCACTCGCGTTAAACGATCCAATTAAACTTTTTAATAAAGAGGATTTACCAGCACCGTTGGGCCCCATAATGCCAATAATTTCTCCTGAAATTGGAATC | 0no label
|
G000006605 | ASM660v1 | GCF_000006605.1 | PRJNA224116 | SAMEA3283089 | null | 2005/06/27 | Bielefeld Univ | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/605/GCF_000006605.1_ASM660v1 | 637,000,085 | RS_GCF_000006605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 306,537 | 38,289 | Corynebacterium jeikeium K411 | strain=K411 = NCTC 11915 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Corynebacteriaceae | Corynebacterium | Corynebacterium jeikeium | true | Corynebacterium jeikeium K411 K411 = NCTC 11915 | Eubacteria | Actinobacteria | 1 | 0.996 | 1 | 1 | 2,476,822 | 2 | 61.35 | 2,462,499 | 1 | 2,137 | 751,284 | 89.378688 | 100 | 0.68 | 0 | 319 | yes | yes | yes | 20 | high | 247,130 | GGGAGCGGTCCTTCAGGAAGCCGATGTACATCACCAGCACCAGACCCATAGCTACGACCAAGCCGGGGAAGAATCCCGCTACCAGCACGTCACCCACGGGAGCCTCCGCGGTGATTGCGTAGAAGACCAGGATGATCGACGGCGGGATCA | 0no label
|
G000007325 | ASM732v1 | GCF_000007325.1 | PRJNA57885 | SAMN02603417 | null | 2002/04/09 | Integrated Genomics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/325/GCF_000007325.1_ASM732v1 | 637,000,117 | RS_GCF_000007325.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 190,304 | 851 | Fusobacterium nucleatum subsp. nucleatum ATCC 25586 | strain=ATCC 25586 | null | Bacteria | Fusobacteria | Fusobacteriia | Fusobacteriales | Fusobacteriaceae | Fusobacterium | Fusobacterium nucleatum | true | Fusobacterium nucleatum subsp. nucleatum ATCC 25586 | Eubacteria | Bacteria | 1 | 1 | 1 | 1 | 2,174,500 | 1 | 27.15 | 2,174,500 | 1 | 2,022 | 670,780 | 90.88917 | 99.95 | 0 | 0 | 297 | yes | yes | yes | 20 | high | 1,999,270 | TAGCCATTTTATTTTTTCAGAATCATCAGTTATTTTTTCATCTACTTCTACATCTTCATACACTCCATCTATATAGCCTCCAAAAAGACAATAACCATCTTTTTTATTTTCTAAAATTTGACTTGAAGATAATAAATAATATGGATATCC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 408,150 | CTGGACACGTCTTCCCGAAACCCCTCTGTCATGGACACGTCTTCCTGAGAACTGGTTGCCCCGGGAACCGCCTGCCCCGGGAACCGCCCGCCCTGGACGCGTCTGTCGGAGTCACATCGCCCCCGTGCTTCTTCTGCCTGAGATTTGGGT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,617,600 | GGACAGAGCTGGTGGGAGGTAATTGAATCATGGGGGCGGGTTTTTCCCATGCTGTTCTGGTGATAGCCAGTAAGTCTCATGAGAGACTTATAAAGGGCACATCCCCTTCACAAGCTCTCTTGCCTGCCACCATGTCAGACACGGCTTTGC | 11
|
G000008165 | ASM816v1 | GCF_000008165.1 | PRJNA58091 | SAMN02598266 | null | 2004/06/24 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/165/GCF_000008165.1_ASM816v1 | 637,000,015 | RS_GCF_000008165.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 260,799 | 1,392 | Bacillus anthracis str. Sterne | strain=Sterne | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Bacillus anthracis str. Sterne ASM816v1 | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,228,663 | 1 | 35.38 | 5,228,663 | 1 | 5,471 | 1,495,624 | 84.251844 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 3,551,080 | TTTTGTAAAGTCTATTTCTGCTACATTAACAAATACAGGTTTACCAGCAAGTTCTCTTGATCTTGAATTAACAGAACGAATTGCAATGATGGATGAGCGAGAAACATTAATAAAACTGCGTACACTAAAGAGTTTAGGCGTTCACATTTC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,498,450 | CAGAGGTTGCAGTGAGCCGAGATTGCACCATTGCCCTCCAGCCTGGGCAAAAAGAGTGAAACTCCATCTCAAAAAACAAAAAGCAAAAACAACTAAAAGAGATACTTAGGAAGTTTTTAAAGATTCCCTTCACCTGAATTTTAGATGTGA | 11
|
G000010625 | ASM1062v1 | GCF_000010625.1 | PRJNA224116 | SAMD00060936 | null | 2008/01/24 | Kazusa DNA Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/625/GCF_000010625.1_ASM1062v1 | 641,522,640 | RS_GCF_000010625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 449,447 | 1,126 | Microcystis aeruginosa NIES-843 | strain=NIES-843 | null | Bacteria | Cyanobacteria | null | Chroococcales | Microcystaceae | Microcystis | Microcystis aeruginosa | true | Microcystis aeruginosa NIES-843 | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 5,842,795 | 1 | 42.33 | 5,842,795 | 1 | 5,605 | 1,591,543 | 80.239081 | 99.89 | 0.51 | 25 | 350 | yes | yes | yes | 20 | high | 4,996,940 | CTGTGTAACGGTAACTTCCTTGATAATTCTTGGCAGTCCAGCTATATCTTTAGCCGATCATAGATCACCAATAACTTTAGCTTCTAGGGATTTATCGAACCAGCAACAGGGACGAACAATTATTCTTAATGGTCGTTCTTTGTCCGTACC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,409,500 | AAATTAACTGGGCATGGTGGCGGTTGCCTGTAATCTCAGCTATACGGGAGGCTGAGGCAGGAGAATTGCTTGAATCTGGGAGGCAGAGGTTGCAGTGAGTGGAGATCGCACCACTGCACTCCAGCCTGGGAGACAGTGTGAGACTCTGTC | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,255,750 | CAGGAGTTTGAGACCAGCCTGGCCAACAAGGTGAATCCCCATCTCTACTGAAAATACAAAAAATTAGCCAGGTGTGGTGGTAGATGCCTGTAATCCCAGCTACTCGGGAGGCTGAGGCCGAAGAATTGCTTGAACCTGGGAGGTGGAGGT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,593,850 | CTCAAGCCATCTTCCCTCCTCGGCCTCCCAAAGTGTTGAGATTATAGGCGTGAGCCACCACAACCGGCCTGCCTCCCAATTCTAGTATTGCAATAGTTTATTTGTTTGCTGCATTAAGTTGTGTTAATTAGGTTAAGGTAGGCACTTGAT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,532,150 | TCACTATTATTGCGTTAATACAACAAACGGTTTTGATTACTCCAGCTTTACAATAAGCCTTGAGGTCAAGTTAATATTATTCCCCCAAATTCAACTTGCTCAAAATTGTTTTGGTTATTCTAGTTTCTTTGCATTTCCATATAAATAACA | 11
|
G000006925 | ASM692v2 | GCF_000006925.2 | PRJNA62907 | SAMN02603599 | null | 2011/08/03 | Microbial Genome Center of ChMPH | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/925/GCF_000006925.2_ASM692v2 | 637,000,264 | RS_GCF_000006925.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 198,214 | 623 | Shigella flexneri 2a str. 301 | strain=301 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Enterobacteriaceae | Shigella | Shigella flexneri | true | Shigella flexneri 2a str. 301 | Eubacteria | Proteobacteria | 1 | 0.998 | 1 | 1 | 4,828,820 | 2 | 50.65 | 4,607,202 | 1 | 5,003 | 1,415,151 | 86.329724 | 99.7 | 0.21 | 0 | 372 | yes | yes | yes | 20 | high | 4,633,460 | AGATATAAGTGGATCACTTTTCATCCGTCGTTGACACAACACTGGCTCTGGTATGCGTACAACACTAAAACTGGCGGTGTGTTGGCTTACACTTTCGGGCCACGGAATGATGAGACCTGTCGGGAACTGTTAGCCCTGTTGACTCCGTTC | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,591,550 | ACATTAGCTGTTAGGACACCCAATGAAATAACCTGGGCACACAGAGACCAACCTTATTAACCGGGGGGTGATGGGAGGCAGGACAGAGCTTCAGGAGCAGTGAGAAGGGTGGGCACCCACCGGGAGGGCTGGGAAGCCTCTCAGCAGCAA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,724,600 | GAGCAGAAGACTGGACTCTGGGCCTCCCGGTTCCAGCGCTCAGTTGCCTGCTGTGTGGCCTTAAAGTCATGAGCCTCTCTGAGCCTCCGGTTCAGCGTAACAGAGACAATCAAACCGGATCATGTACGTGGGACTTTTTTCCAGAAGATG | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,701,050 | TAGATGAATGGATGGATGACGGGTGGATAGATGGATGAATGGTGGGTACAGGAATGGATGGATGGTGGGTGGTGGATGAATGGATGGAAGCATGAATGGTGGATGGGCAGATGGATGGATGGTGGATGGGCAGATGGATGGATGGTGGAT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,257,500 | TCTCAATTTTCTACATTTAACATCTGACAAAAACCAGCTTTTATCTTTACCAAAGATATTCTATCCCTAGAAAGTCACTATTTAAAATGATGTCATTTATATCATGTAACATATTAAGAAATACATTTATTTTATTTTTGGTAGTAACAA | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 618,900 | CGGGTTCAAATGATTCTCCTGCCTCAGCTTCCCGAGTAGCTGGGACTAAGGGCACGTGCCACCACTCCCAGCTAATTTTTTTGTATTTCTAATGGAGATGGGGTTTCACCATGCTGGCAAGGCTGGTCTCAAACTCTCTTTTTCTAATTT | 11
|
G000008865 | ASM886v1 | GCF_000008865.1 | PRJNA57781 | SAMN01911278 | null | 2004/05/11 | GIRC | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/865/GCF_000008865.1_ASM886v1 | 637,000,108 | RS_GCF_000008865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 386,585 | 562 | Escherichia coli O157:H7 str. Sakai | strain=Sakai substr. RIMD 0509952 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Enterobacteriaceae | Escherichia | Escherichia coli | true | Escherichia coli O157:H7 str. Sakai Sakai substr. RIMD 0509952 | Eubacteria | Proteobacteria | 1 | 0.996 | 0.9 | 1 | 5,594,477 | 3 | 50.48 | 5,498,450 | 1 | 5,399 | 1,663,868 | 87.620737 | 99.97 | 0.33 | 0 | 374 | yes | yes | yes | 20 | high | 2,026,310 | CAGTTTGCAAGCGGTAACTGAACCGGGCGATTGGGTGATAGTAGAGAATCCTTGTTTCTACGGTGCGTTGCAGGCGCTGGAGCGGCTACGGCTGAAGGCGTTATCGGTGGCGACGGATGTTAAAGAAGGGATCGATCTTCAGGCGCTGGA | 0no label
|
G000007785 | ASM778v1 | GCF_000007785.1 | PRJNA57669 | SAMN02603978 | null | 2003/03/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/785/GCF_000007785.1_ASM778v1 | 637,000,101 | RS_GCF_000007785.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,185 | 1,351 | Enterococcus faecalis V583 | strain=V583 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Enterococcaceae | Enterococcus | Enterococcus faecalis | true | Enterococcus faecalis V583 ASM778v1 | Eubacteria | Firmicutes | 0.99 | 0.991 | 1 | 1 | 3,359,974 | 4 | 37.38 | 3,218,031 | 1 | 3,271 | 1,000,353 | 87.714339 | 99.53 | 0.31 | 0 | 309 | yes | yes | yes | 20 | high | 2,961,660 | TGCAGTCGATGAACCTGTGATTGACGTTACAGAAAAATATCCTCAAGCAACAGAAACGCCAAAAGAAGAGCCAACAGCTAAAAAAAGCTTTTGGCAAAAACTATTTCACTCATAAAAAGCTCAAGGAAAGTTATGAGCGCTTCCATTTTA | 0no label
|
G000007825 | ASM782v1 | GCF_000007825.1 | PRJNA57975 | SAMN02603340 | null | 2004/07/06 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/825/GCF_000007825.1_ASM782v1 | 637,000,017 | RS_GCF_000007825.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,900 | 1,396 | Bacillus cereus ATCC 14579 | strain=ATCC 14579 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus cereus | true | Bacillus cereus ATCC 14579 | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,427,083 | 2 | 35.29 | 5,411,809 | 1 | 5,541 | 1,546,426 | 83.933929 | 98.18 | 0.58 | 18.18 | 383 | yes | yes | yes | 20 | high | 4,583,670 | ACTGGCTGTATATCGATAATGGCTTGCAAGTTTTTCATTCTTTCTATCAACTCTTCACGAGCAAGCTGACAATGAATAATACGGTCACGTAACCCTTCTGCTGGTGGATATAATTCGAGTGCATCAATGACATATTCAAGCGATAAGTCA | 0no label
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,104,600 | CTTCAGCAATAGGCTGACAGCTTTGAGCTTGGTCAGTCAAGACATAGGCCTGGCATTGGGCCAGGGCCAGTCTGGAAGTCAGATTCACGTTTTCCTTTTCCAGCTTACATTTCTCTTGAAGCAACCAGTTTCTATCTTGACATATCAACT | 11
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | homo sapiens | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,702,400 | GTCCCCATACTACAAGTGGGCACACCGAGGAGAGGGCTGCCTGGCTTGTCCAAGACCACTCAGCTAATGCTCAGAGCTAGAAGCCAAGGCCTCATCCCACCAGCTCTTGACCCCTGGCTTCAACCAGCCACCCCAACTCCCAGGAGAATC | 11
|
G000007025 | ASM702v1 | GCF_000007025.1 | PRJNA224116 | SAMN02603141 | null | 2002/11/25 | CNRS | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/025/GCF_000007025.1_ASM702v1 | 637,000,243 | RS_GCF_000007025.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 272,944 | 781 | Rickettsia conorii str. Malish 7 | strain=Malish 7 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rickettsiales | Rickettsiaceae | Rickettsia | Rickettsia conorii | true | Rickettsia conorii str. Malish 7 | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 1,268,755 | 1 | 32.44 | 1,268,755 | 1 | 1,435 | 347,621 | 80.686027 | 99.46 | 0.33 | 0 | 218 | yes | yes | yes | 20 | high | 1,099,280 | TTACTTACGTAATTTCCTCGCAATGACGATTTGATACTCACGCAGGCGTAACACCAACACCCATAAAACAAAAAACTATCTAATATGATTTCGATATTTAGTAAATTAAAACAAAGTTTATCTAAAACTTCTAATAAAATATCGGAAGGT | 0no label
|