RaphaelMourad
commited on
Commit
•
c1f959a
1
Parent(s):
9456a46
Update README.md
Browse files
README.md
CHANGED
@@ -6,11 +6,11 @@ tags:
|
|
6 |
- protein
|
7 |
---
|
8 |
|
9 |
-
# Model Card for Mistral-
|
10 |
|
11 |
-
The Mistral-
|
12 |
It is derived from Mixtral-8x7B-v0.1 model, which was simplified for protein: the number of layers and the hidden size were reduced.
|
13 |
-
The model was pretrained using
|
14 |
|
15 |
## Model Architecture
|
16 |
|
@@ -26,14 +26,14 @@ Like Mixtral-8x7B-v0.1, it is a transformer model, with the following architectu
|
|
26 |
import torch
|
27 |
from transformers import AutoTokenizer, AutoModel
|
28 |
|
29 |
-
tokenizer = AutoTokenizer.from_pretrained("RaphaelMourad/Mistral-
|
30 |
-
model = AutoModel.from_pretrained("RaphaelMourad/Mistral-
|
31 |
```
|
32 |
|
33 |
## Calculate the embedding of a protein sequence
|
34 |
|
35 |
```
|
36 |
-
insulin = "
|
37 |
inputs = tokenizer(insulin, return_tensors = 'pt')["input_ids"]
|
38 |
hidden_states = model(inputs)[0] # [1, sequence_length, 256]
|
39 |
|
@@ -48,7 +48,7 @@ Ensure you are utilizing a stable version of Transformers, 4.34.0 or newer.
|
|
48 |
|
49 |
## Notice
|
50 |
|
51 |
-
Mistral-
|
52 |
|
53 |
## Contact
|
54 |
|
|
|
6 |
- protein
|
7 |
---
|
8 |
|
9 |
+
# Model Card for Mistral-DNA-v1-17M-hg38 (Mistral for protein)
|
10 |
|
11 |
+
The Mistral-DNA-v1-17M-hg38 Large Language Model (LLM) is a pretrained generative DNA sequence model with 16.8M parameters.
|
12 |
It is derived from Mixtral-8x7B-v0.1 model, which was simplified for protein: the number of layers and the hidden size were reduced.
|
13 |
+
The model was pretrained using 10kb DNA sequences from the hg38 human genome assembly.
|
14 |
|
15 |
## Model Architecture
|
16 |
|
|
|
26 |
import torch
|
27 |
from transformers import AutoTokenizer, AutoModel
|
28 |
|
29 |
+
tokenizer = AutoTokenizer.from_pretrained("RaphaelMourad/Mistral-DNA-v1-17M-hg38", trust_remote_code=True)
|
30 |
+
model = AutoModel.from_pretrained("RaphaelMourad/Mistral-DNA-v1-17M-hg38", trust_remote_code=True)
|
31 |
```
|
32 |
|
33 |
## Calculate the embedding of a protein sequence
|
34 |
|
35 |
```
|
36 |
+
insulin = "TGATGATTGGCGCGGCTAGGATCGGCT"
|
37 |
inputs = tokenizer(insulin, return_tensors = 'pt')["input_ids"]
|
38 |
hidden_states = model(inputs)[0] # [1, sequence_length, 256]
|
39 |
|
|
|
48 |
|
49 |
## Notice
|
50 |
|
51 |
+
Mistral-DNA-v1-17M-hg38 is a pretrained base model for DNA.
|
52 |
|
53 |
## Contact
|
54 |
|