Create README.md

README.md

@@ -0,0 +1,103 @@
+---
+license: cc-by-nc-sa-4.0
+widget:
+- text: ACCTGA<mask>TTCTGAGTC
+tags:
+- DNA
+- biology
+- genomics
+- segmentation
+---
+# segment-nt-30kb-multi-species
+
+Segment-NT-30kb-multi-species is a segmentation model leveraging the [Nucleotide Transformer](https://huggingface.co/InstaDeepAI/nucleotide-transformer-v2-500m-multi-species) (NT) DNA foundation model to predict the location of several types of genomics 
+elements in a sequence at a single nucleotide resolution. It is the result of finetuning the [Segment-NT-30kb](https://huggingface.co/InstaDeepAI/segment_nt_30kb) model on a dataset encompassing the human genome 
+but also the genomes of 5 selected species: mouse, chicken, fly, zebrafish and worm. 
+
+For the finetuning on the multi-species genomes, we curated a dataset of a subset of the annotations used to train **Segment-NT-30kb**, mainly because only this subset of annotations is
+available for these species. The annotations therefore concern the 7 main gene elements available from Ensembl [REF], namely protein-coding gene, 5’UTR, 3’UTR, intron, exon, 
+splice acceptor and donor sites. 
+
+
+**Developed by:** [InstaDeep](https://huggingface.co/InstaDeepAI)
+
+### Model Sources
+
+<!-- Provide the basic links for the model. -->
+
+- **Repository:** [Nucleotide Transformer](https://github.com/instadeepai/nucleotide-transformer)
+- **Paper:** [Segmenting the genome at single-nucleotide resolution with DNA foundation models]() TODO: Add link to preprint
+
+### How to use
+
+<!-- Need to adapt this section to our model. Need to figure out how to load the models from huggingface and do inference on them -->
+Until its next release, the `transformers` library needs to be installed from source with the following command in order to use the models:
+```bash
+pip install --upgrade git+https://github.com/huggingface/transformers.git
+```
+
+A small snippet of code is given here in order to retrieve both logits and embeddings from a dummy DNA sequence.
+```python
+# Load model and tokenizer
+from transformers import AutoTokenizer, AutoModel
+import torch
+
+tokenizer = AutoTokenizer.from_pretrained("InstaDeepAI/segment_nt_30kb_multi_species", use_auth_token=hf_token, trust_remote_code=True)
+model = AutoModel.from_pretrained("InstaDeepAI/segment_nt_30kb_multi_species", use_auth_token=hf_token, trust_remote_code=True)
+
+
+# Choose the length to which the input sequences are padded. By default, the 
+# model max length is chosen, but feel free to decrease it as the time taken to 
+# obtain the embeddings increases significantly with it.
+max_length = tokenizer.model_max_length
+
+# Create a dummy dna sequence and tokenize it
+sequences = ["ATTCCGATTCCGATTCCG", "ATTTCTCTCTCTCTCTGAGATCGATCGATCGAT"]
+tokens_ids = tokenizer.batch_encode_plus(sequences, return_tensors="pt", padding="max_length", max_length = max_length)["input_ids"]
+
+# Compute the embeddings
+attention_mask = torch_tokens != tokenizer.pad_token_id
+outs = model(
+    torch_tokens,
+    attention_mask=attention_mask,
+    output_hidden_states=True
+)
+
+logits = outs.logits.detach().numpy()
+probabilities = torch.nn.functional.softmax(logits, dim=-1)
+```
+
+
+## Training data
+
+The **segment-nt-30kb-multi-species** model was finetuned on human, mouse, chicken, fly, zebrafish and worm genomes. For each specie, a subset of chromosomes is kept as 
+validation for training monitoring and test for final evaluation.
+
+## Training procedure
+
+### Preprocessing
+
+The DNA sequences are tokenized using the Nucleotide Transformer Tokenizer, which tokenizes sequences as 6-mers tokens as described in the [Tokenization](https://github.com/instadeepai/nucleotide-transformer#tokenization-abc) section of the associated repository. This tokenizer has a vocabulary size of 4105. The inputs of the model are then of the form:
+
+```
+<CLS> <ACGTGT> <ACGTGC> <ACGGAC> <GACTAG> <TCAGCA>
+```
+
+### Training
+
+The model was finetuned on a DGXH100 node with 8 GPUs on a total of 8B tokens for 3 days. 
+
+
+### Architecture
+
+The model is composed of the [nucleotide-transformer-v2-50m-multi-species](https://huggingface.co/InstaDeepAI/nucleotide-transformer-v2-500m-multi-species) encoder, from which we removed 
+the language model head and replaced it by a 1-dimensional U-Net segmentation head [4] made of 2 downsampling convolutional blocks and 2 upsampling convolutional blocks. Each of these 
+blocks is made of 2 convolutional layers with 1, 024 and 2, 048 kernels respectively. This additional segmentation head accounts for 53 million parameters, bringing the total number of parameters
+to 562M.
+
+### BibTeX entry and citation info
+
+#TODO: Add bibtex citation here
+```bibtex
+
+```